Deletion of Stat3 in hematopoietic cells enhances thrombocytosis and shortens survival in a JAK2-V617F mouse model of MPN

Myeloproliferative neoplasms (MPNs) are characterized by aberrant proliferation of the erythroid, megakaryocytic, or myeloid lineages. MPNs are subdivided into 3 disease entities: polycythemia vera, essential thrombocythemia, and primary myelofibrosis. The acquired JAK2-V617F somatic mutation is present in the majority of patients with MPN and present in the different disease entities.^1-4  Downstream of constitutively active JAK2-V617F, signal transducer and activator of transcription (Stat) proteins are phosphorylated, leading to the translocation of Stat protein dimers to the nucleus where they bind to cognate elements on the promoters of responsive genes. Stat5 is essential in the pathogenesis of MPN and deletion of Stat5 in JAK2-V617F transgenic mouse models abrogated the disease phenotypes.^5,6  Activation of Stat1 constrains erythroid differentiation in MPN patients,⁷  and loss of Stat1 decreases megakaryopoiesis and favors erythropoiesis in a JAK2-V617F–driven mouse model of MPN.⁸  In contrast, the impact of Stat3 in JAK2-V617F–driven MPN is less well understood. Stat3 was shown to play a role in hematopoiesis in the context of hyperactive gp130 signaling.^9,10  Although overexpression of a dominant negative form of Stat3 did not affect the baseline number of megakaryocytes and platelets, the rate of platelet recovery following 5-fluorouracil treatment was delayed.¹¹  Depending on the cellular context, Stat3 can act as a tumor suppressor or as an oncogene. A constitutive active version of Stat3 suppressed transformation of mouse embryonic fibroblasts deficient for p53, but expression of the activated Stat3 in bone marrow cells induced a highly aggressive T-cell leukemia in mice.¹²  There is also interest in Stat3 as a potential drug target in chronic myeloid leukemia.¹³ 

Here, we studied the role of Stat3 in a mouse model of JAK2-V617F–positive MPN. JAK2-V617F transgenic mice were crossed with a conditional knockout of Stat3,¹⁴  and bone marrow cells from double mutant mice were transplanted into lethally irradiated recipients. This allowed us to study the role of Stat3 in JAK2-V617F–driven MPN.

Mice carrying a floxed conditional knockout allele of Stat3^fl/fl, kindly provided by Valeria Poli, University of Torino, Torino, Italy,¹⁴  were crossed with the SclCre^ER mice,¹⁵  and conditional transgenic mice expressing the human JAK2-V617F.¹⁶  All strains were bred on the C57BL/6N background for >10 generations. Bone marrow transplantations were performed with 2 × 10⁶ total bone marrow cells from SclCre;Stat3^fl/+, SclCre;Stat3^fl/fl, SclCre;V617F, SclCre;V617F;Stat3^fl/+, and SclCre;V617F;Stat3^fl/fl mice or wild-type (WT) controls injected into tail veins of lethally irradiated (12 Gy) C57BL/6N (8 weeks old; Harlan Laboratories, Fullinsdorf, Switzerland). The Cre^ER chimeric protein was activated 6 weeks after transplantation for a period of 6 successive weeks by supplying tamoxifen supplemented with 10% sucrose with the food (1 mg/g; Harlan Laboratories, Venray, The Netherlands). Alternatively, to activate the JAK2-V617F transgene and to induce the excision of Stat3, the JAK2-V617F and Stat3^fl/fl mice were crossed with MxCre mice.¹⁷ Cre expression in transplanted MxCre mice was induced by intraperitoneal injection of 300 µg polyinosine-polycytosine (pIpC) 3 times every second day. All experiments were done in strict adherence to Swiss laws for animal welfare and approved by the Swiss Cantonal Veterinary Office of Basel-Stadt.

Blood was collected into EDTA-coated microtainers (Becton Dickinson and Company) by tail vein sampling technique prior to the start of dosing and by cardiac puncture as a part of the take-down procedure. Complete blood counts were determined on the ADVIA 120 Hematology Analyzer using Multispecies Software (Bayer, Leverkusen, Germany). Bone marrow (sternum and femur), spleen, liver, and intestines for histopathological analysis were fixed in 4% phosphate-buffered formalin and then embedded in paraffin. Formalin-fixed, paraffin-embedded tissue sections were stained with hematoxylin-eosin and Gömöri (analysis of the amount and distribution of reticulin fibers).

Single-cell suspensions from bone marrow and spleen were stained with fluoroisothiocyanate-, phycoerythrin (PE)-, PE/Cy7-, and allophycocyanin-conjugated, anti-mouse monoclonal antibodies against CD41/61, CD42c, cKit, Sca1, CD41, CD150, Ter119, Mac1, and Gr1; and biotin-conjugated anti-mouse antibody against CD71, Ter119, B220, Gr1, CD4, CD8, MAC1, and IL7R, followed by streptavidin-allophycocyanin or streptavidin-pacific blue staining (BioLegend, San Diego, CA or Emfret Analytics, Eibelstadt, Germany). The analysis of Lin⁻Sca1⁺c-kit⁺ (LSK) cells, Lin⁻Sca1⁻c-kit⁺ (LK) cells, and megakaryocytic progenitors was performed after lineage depletion using the MagCellect cell enrichment kit (R&D System, Minneapolis, MN). The cells were analyzed on a flow cytometer (CyAn, Beckman-Coulter, Nyon, Switzerland).

For phospho-flow analysis, isolated bone marrow or spleen cells were stimulated (15 minutes, 37°C) with interleukin (IL)-6 (10 ng/mL) or thrombopoietin (Tpo) (20 ng/mL), fixed with 4% formaldehyde, and permeabilized in 90% methanol. Cells were stained first with anti-phospho(Y701)Stat1 or anti-phospho(Y705)Stat3 rabbit antibodies followed by Alexa647-labeled anti-rabbit antibody (LuBio Science GmbH) together with anti-CD71 fluoroisothiocyanate-conjugated and anti-CD41 PE-conjugated anti-mouse antibodies (BioLegend). The samples were analyzed on a CyAn flow cytometer.

Expression analysis in peripheral blood, bone marrow, and spleen samples was performed with Power SYBR Green PCR Master mix on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) using the following primers: AGACTCTGGGGATGTTGCTG and CCTCCATTCCCACATCTCTG for Stat3, GAAGCGAATGATTGTCAGCA and TTCCTCGTCTGGATTCCATC for Gata1, CAGGTCTCCACAAGCACAAA and CCAGCCTCTCAGGGACACTA for NF-E2, GTGCAGAGGGCAAGGCAAGT and TGACTCAGAGCTGAGGGTCG for Gp1βα, CGTGCTTGAGAGGGTCATTTG and GGTCGGGAGTCCACAACTTC for USP18, TCAGCAGGGGTCCTTGGACTCTC and CATCTCCTGCGTAGTCTGTACAGGC for IFI27l2α, and CGGCGGAGAGAGCTTTGC and AGCTGAAACGACTGGCTC for Stat1. The primers for Gusb were ATAAGACGCATCAGAAGCCG and ACTCCTCACTGAACATGCGA.

Colony forming unit megakaryocyte (CFU-MK) colonies were grown in duplicate chamber slides using a collagen-based medium (MegaCult-C; Stemcell Technologies, Vancouver, BC, Canada) containing 50 ng/mL recombinant mouse (rm)IL-11, 10 ng/mL rmIL-3, 20 ng/mL rmIL-6, and 50 ng/mL rhTpo (PeproTech). Bone marrow or spleen cells (1 × 10⁵) were plated per one double chamber slide and cultured at 37°C with 5% CO₂ and 95% humidity for 8 days. Then the slides were fixed, stained, and scored according the manufacturer’s protocol. Erythroid progenitors were assayed in M3436 medium (Stemcell Technologies). Bone marrow or spleen cells (2 × 10⁵) were plated, and burst-forming unit erythroid (BFU-E) colonies were scored after 14 days in culture. Myeloid progenitor colony assay was performed using methylcellulose-based medium (M3534; Stemcell Technologies). Bone marrow or spleen cells (2 × 10⁴ and 1 × 10⁵ cells respectively) were plated and scored for formation of colony forming unit granulocyte (CFU-G) at day 7 of culture.

The Stat3 inhibitor S3I-201 was previously used in mouse experiments in vivo.¹⁸  S3I-201 was purchased from Merck (Schaffhausen, Switzerland). S3I-201 (5 mg/kg) or vehicle was injected intravenously every second day for 2 weeks in our mouse model of JAK2-V617F–driven MPN.

Results are presented as means ± standard error of the mean (SEM). To assess statistical significance among individual cohorts, 1-way or 2-way analysis of variance (ANOVA) with subsequent Bonferroni post-test (Graph Pad Prism, vs 4.00, 2003) was used, and P < .05 was considered significant.

To examine the effects of Stat3 deletion on the MPN phenotype, we crossed our inducible JAK2-V617F transgenic mice (hereafter called V617F) with the conditional Stat3^fl/fl knockout mice.^14,16  We generated triple transgenic mice with the SclCre^ER strain that express the tamoxifen-inducible Cre-estrogen receptor (Cre^ER) fusion protein in hematopoietic stem and progenitor cells.^15,19  This allowed the activation of the expression of JAK2-V1617F and at the same time excision of the conditional Stat3^fl/fl allele by administering tamoxifen. To obtain sufficient numbers of mice with all relevant genotypes for analysis and to restrict the gene mutations to hematopoietic cells only, we performed transplantations of noninduced bone marrow cells into lethally irradiated C57BL/6N recipients. Starting at 6 weeks after bone marrow transplantation, tamoxifen was added in the food (1 mg/g) and continued during the next 6 weeks. Blood counts were determined in the recipients before and after tamoxifen induction (Figure 1A). All SclCre;V617F-expressing transgenic mice showed increased hemoglobin levels irrespective of the Stat3 genotype, whereas thrombocytosis was more pronounced in SclCre;V617F;Stat3^fl/fl mice than in SclCre;V617F;Stat3^+/+ mice at 24 and 30 weeks after transplantation (Figure 1A). Variable neutrophilia was observed in SclCre;V617F;Stat3^+/+ and SclCre;V617F;Stat3^fl/+ mice but not in SclCre;V617F;Stat3^fl/fl mice. The blood counts of SclCre;Stat3^fl/+ mice and SclCre;Stat3^fl/fl remained normal. At 25 weeks after starting tamoxifen, the mice were euthanized for detailed analysis. Splenomegaly was observed in all mice expressing JAK2-V617F (Figure 1B). However, deleting Stat3 significantly lowered the spleen weight in JAK2-V617F–expressing mice. JAK2-V617F and homozygous loss of Stat3 both had a negative impact on survival (Figure 1C). Loss of Stat3 in our JAK2-V617F mice had the worst prognosis, and survival was significantly lower than SclCre;V617F;Stat3^+/+ mice. We found a 94% and 82% reduction of Stat3 mRNA in bone marrow of SclCre;Stat3^fl/fl mice and SclCre;V617F;Stat3^fl/fl mice, respectively (Figure 1D), indicating that the tamoxifen-induced deletion of Stat3 was substantial.

The effects of Stat3 deletion on the platelets and neutrophil phenotype were confirmed in crossings where the interferon-inducible MxCre was used instead of SclCre (supplemental Figure 1 available on the Blood Web site). In MxCre mice, the Cre expression can sometimes be induced by endogenous interferon prior to administering pIpC, as also observed in the MxCre;V617F and MxCre;V617F;Stat3^fl/+ mice at 6 weeks after transplantation (supplemental Figure 1A). MxCre-induced deletion of Stat3 did not result in decreased spleen weight (supplemental Figure 1B), but survival was decreased in MxCre;Stat3^fl/fl mice and MxCre;V617F;Stat3^fl/fl mice (supplemental Figure 1C). We found a 52% and 99% reduction of Stat3 mRNA in MxCre;Stat3^fl/fl mice and MxCre;V617F;Stat3^fl/fl mice, respectively (supplemental Figure 1D). The incomplete deletion of Stat3 suggests that some cells that retain expression of Stat3 are still present. In our model, we cannot distinguish between incomplete excision and partially autologous reconstitution. Overall, both SclCre and MxCre JAK2-V617F models showed accentuation of thrombocytosis on homozygous loss of Stat3.

Mice expressing JAK2-V617F showed typical histopathological features of MPN with trilineage hyperplasia, increased numbers of atypical megakaryocytes, and the presence of reticulin fibers in the bone marrow, together with destruction of normal splenic architecture by infiltrates of highly atypical hematopoiesis (Figure 2). In comparison with SclCre;V617F;Stat3^+/+ mice, SclCre;V617F;Stat3^fl/fl mice had enhanced numbers and clusters of atypical megakaryocytes both in the bone marrow and spleen and showed a trend toward augmented myelofibrosis when groups of 3 mice per genotype were analyzed. Similar findings were observed in MxCre;V617F;Stat3^fl/fl (supplemental Figure 2). SclCre;Stat3^fl/fl mice with WT Jak2 showed slight hypercellularity and increased numbers of megakaryocytes, but these megakaryocytes were not atypical and did not cluster. Furthermore, reticulin staining (Gömöri) did not reveal the presence of reticulin fibers (Figure 2). In MxCre;Stat3^fl/fl mice with WT Jak2, signs of inflammation and colitis (neutrophilic infiltration in the large bowel) were present in the intestine from half of the cases studied (supplemental Figure 2). Interestingly, 2 MxCre;Stat3^fl/fl mice showed a preneoplastic (adenoma-like) lesion in the gut (supplemental Figure 2, bottom). The presence of colon lesions and the increased degree of inflammation in MxCre;Stat3^fl/fl mice could be linked to their shortened survival in comparison with the SclCre;Stat3^fl/fl mice.

To assess the hematopoietic progenitor cell compartment in more detail, we performed flow cytometry analysis and colony assays. In SclCre;V617F mice, the erythroid precursors, measured as numbers of CD71/Ter119 double-positive cells, was decreased in bone marrow and increased in spleen (Figure 3A-B). Stat3 excision had no effect on these alterations, except for the numbers of most mature Ter119-positive erythroblasts (region IV) that were significantly increased in the spleen of SclCre;V617F;Stat3^fl/fl vs SclCre;V617F;Stat3^+/+ mice. Stat3 deletion did not alter the numbers of BFU-E colonies in the bone marrow or spleen of JAK2-V617F mice, but a trend toward increased number of BFU-E colonies was observed in the spleen from SclCre;Stat3^fl/fl vs WT mice (Figure 3C). Megakaryocytes were determined with an antibody recognizing the CD41/CD61 complex and with an anti-CD42c antibody (Figure 3D-E). Mice expressing the JAK2-V617F transgene showed significantly increased numbers of CD41/CD61;CD42c double-positive megakaryocytes in the spleen but not in bone marrow. Deletion of Stat3 further enhanced the percentages of megakaryocytes in the spleen and also in the bone marrow from JAK2-V617F–expressing mice (Figure 3D-E). Similar data using CD41 alone were obtained in the MxCre mouse model (supplemental Figure 3). The numbers of CFU-MK colonies were increased in both bone marrow and spleen of SclCre;V617F mice vs WT or SclCre;Stat3^fl/fl mice (Figure 3F), and SclCre;V617F;Stat3^fl/fl mice showed a trend toward higher bone marrow and lower spleen CFU-MKs compared with SclCre;V617F;Stat3^+/+ mice. The myeloid lineages were less affected by JAK2-V617F, but a trend toward increased numbers was observed in comparison with WT (Figure 3G-H; supplemental Figure 3). The number of CFU-G colonies was increased in the bone marrow from SclCre;V617F mice, and deletion of Stat3 had no effect on these numbers (Figure 3I).

We further examined the hematopoietic progenitor compartment (Figure 4). The Sca1⁺/c-Kit⁺ cells in LSK cells were elevated in the spleen and showed a trend toward higher numbers in the bone marrow of SclCre;V617F;Sta3^+/+ mice compared with WT or SclCre;Stat3^fl/fl mice (Figure 4A-B). SclCre;V617F;Stat3^fl/fl mice showed a trend toward higher LSK in the spleen compared with SclCre;V617F;Stat3^+/+ mice. The proportion of Sca1⁻/c-Kit⁺ cells in LK cells was unaltered in bone marrow, but was significantly elevated in the spleen of SclCre;V617F;Sta3^+/+ mice. The proportion of early megakaryocyte progenitors (MkPs), measured as CD150⁺/CD41⁺ LK cells, were significantly augmented in the bone marrow of SclCre;V617F;Stat3^+/+ mice compared with WT mice. The loss of Stat3 in SclCre;V617F mice resulted in a significant increase of MkP progenitors in the spleen. Overall, the loss of Stat3 in JAK2-V617F–expressing mice was associated with a trend or a significant increase in MkPs and mature megakaryocytes.

To assess the effects of Stat3 deficiency on signaling by other Stat proteins, we performed phospho-flow analysis in total bone marrow or spleen and in CD41⁺ megakaryocytic bone marrow or spleen cells (Figure 5). We measured the phosphorylation of Stat1 (pY701Stat1) and Stat3 (pY705Stat3) using specific antibodies. The phosphorylation of Stat1 was increased in total bone marrow and in total spleen cells from SclCre;V617F;Stat3^fl/fl mice compared with SclCre;V617F;Stat3^+/+ mice (Figure 5A-B). A trend toward an increase Stat1 phosphorylation was also noticed in CD41⁺ spleen cells from SclCre;V617F;Stat3^fl/fl mice compared with SclCre;V617F;Stat3^+/+ mice (Figure 5B). Phosphorylation of Stat3 was strongest when stimulated with IL-6, as expected, and pStat3 was strongly reduced in the SclCre;Stat3^fl/fl mice. These mice showed some residual of pStat3 activity in bone marrow and spleen, most likely due to incomplete excision of Stat3 by Cre recombinase. Overall, the loss of Stat3 in JAK2-V617F expressing mice led to increased phosphorylation levels of Stat1.

To further characterize the effects of Stat3 deficiency and the differences in Stat1 signaling, we analyzed the mRNA expression levels of megakaryocytic differentiation markers and Stat1 target genes in peripheral blood, bone marrow, and spleen tissues (Figure 6). Expression of the megakaryocytic differentiation marker Gp1bα was significantly elevated in bone marrow and spleen from SclCre;V617F;Stat3^fl/fl mice compared with SclCre;V617F;Stat3^+/+ mice (Figure 6A), whereas Gata1 and NF-E2 showed only a trend toward higher expression levels. We further analyzed expression of Stat1 and the Stat1 target genes Usp18 and Ifi27l2α (Figure 6B). Stat1 and Usp18 mRNAs were significantly elevated in peripheral blood, bone marrow, and spleen from SclCre;V617F;Stat3^fl/fl mice compared with SclCre;V617F;Stat3^+/+ mice, whereas IFI27l2α was significantly higher only in bone marrow. These findings suggest that deletion of Stat3 augmented expression of megakaryocytic markers, and this increase may be in part due to the increase in Stat1 mRNA expression and Stat1 protein phosphorylation. A trend toward increased mRNA expression of Stat1 and Usp18 was also noted in sorted CD41 cells from bone marrow of SclCre;V617F;Stat3^fl/fl mice, but the Stat1 target gene Ifi27l2a showed a trend toward lower expression, whereas no differences in Stat3 deletion efficiency were noted (supplemental Figure 4). These data are consistent with a less pronounced phosphorylation of Stat1 in CD41⁺ cells compared with total bone marrow (Figure 5A). In agreement with a previous study,²⁰  we also found a decrease of Socs3 mRNA expression in SclCre;Stat3^fl/fl mice compared with WT controls (supplemental Figure 5A). Expression of JAK2-V617F increased the Socs3 mRNA levels, and deleting Stat3 on the JAK2-V617F background decreased the Socs3 levels. Socs3 protein was weakly detected at basal state in our cell lysates (supplemental Figure 5B), and the faint signals obtained suggest that Socs3 protein levels decreased in JAK2-V617F mice in comparison with WT and that Stat3 deletion further reduced Socs3 protein content. Thus, decreased expression of Socs3 could contribute to increasing the effects of Stat1 overactivation in SclCre;V617F;Stat3^fl/fl mice. We also tested the hypothesis that JAK2-V617F preferentially phosphorylates Stat1 compared with Jak2-WT. Phosphorylation of Stat1 was increased in BaF3 cells transduced with mouse Jak2-V617F, and the same trend was also seen with the human JAK2-V617F (supplemental Figure 5C). Altogether, these data suggest that signaling in the absence of Stat3 favors Stat1-driven gene expression, in particular when JAK2-V617F is coexpressed.

Finally, we tested the Stat3 inhibitor S3I-201 (NSC74859), an SH2 domain analog, which prevents dimerization and selectively inhibits Stat3 DNA-binding activity.¹⁸  Similar to the Stat3-deficient mice, the S3I-201–treated mice showed a trend toward increasing the platelet counts compared with vehicle when Stat1 was present, but this increase in platelet count was abolished in SclCre;V617F;Stat1^−/− mice (Figure 7A). Spleen weight also showed dependence on the Stat1 genotype (Figure 7B). In addition, an increase in CD41⁺ cells was found in the bone marrow of SclCre;V617F;Stat1^+/+ mice on S3I-201 inhibitor treatment, whereas a slight decrease in CD41⁺ cells was noted in SclCre;V617F;Stat1^−/− mice (Figure 7C). Overall, these findings suggest that the effect of Stat3 deletion may in part depend on Stat1 activity.

We examined the role of Stat3 in MPNs and found that JAK2-V617F;Stat3^fl/fl mice displayed higher platelet counts and increased numbers of mature megakaryocytes and MkPs compared with JAK2-V617F;Stat3^+/+ mice. Erythropoiesis was unaffected in SclCre;V617F;Stat3^fl/fl mice (Figure 1), but MxCre;V617F;Stat3^fl/fl mice showed slightly decreased red cell parameters in peripheral blood compared with MxCre;V617F;Stat3^+/+ controls (supplemental Figure 1). Neutrophil counts were lower in SclCre;V617F;Stat3^fl/fl and MxCre;V617F;Stat3^fl/fl mice than in the corresponding V617F;Stat3^+/+ controls.

Tpo and Mpl signaling is primarily dependent on Stat5 activation and conditional Stat5 knockout normalized blood counts in JAK2-V617F–driven models of MPN.^5,6  Furthermore, Stat1 promotes megakaryopoiesis downstream of Gata1,²¹  and deletion of Stat1 in the presence of JAK2-V617F reduced megakaryopoiesis and favored erythropoiesis in a mouse model of MPN.⁸  We therefore hypothesized that the increased platelet counts in Stat3-deleted JAK2-V617F mice could be due to compensatory increase in the activation of Stat1 proteins. Phosphoflow data in bone marrow and spleen cells showed enhanced pStat1 activity in SclCre;V617F;Stat3^fl/fl vs SclCre;V617F;Stat3^+/+ mice (Figure 5). Stat3 deletion in JAK2-V617F transgenic mice also resulted in increased mRNA expression levels of Stat1 and of Stat1 target genes. Consistent with the weak increase in Stat1 phosphorylation in CD41⁺ cells (Figure 5), expression of Stat1 target genes showed a trend toward increase in CD41 sorted bone marrow cells from SclCre;V617F;Stat3^fl/fl mice (supplemental Figure 4B). Stat1 and Stat3 activation are known to be reciprocally regulated and perturbation in their balanced expression and/or phosphorylation levels may redirect cytokine/growth factor signals.²²  Indeed, interferon γ-like response to IL-6 in the absence of Stat3 was reported together with prolonged Stat1 activation and the induction of Stat1-dependent genes by IL-6.^23,24  In agreement with previous data,²⁰  the impaired mRNA expression of Socs3 and further decrease in Socs3 protein content on Stat3 deletion in mice expressing JAK2-V617F might also contribute to the increase Stat1 activity in these mice (supplemental Figure 5A-B). In line with our genetic data, we found that inhibiting Stat3 using the Stat3 inhibitor S3I-201 showed a tendency toward increased platelet counts, but this effect was abolished when Stat1 was absent (Figure 7). Consistent with our published data,⁸  the platelet count was overall lower in JAK2-V617F–expressing mice with Stat1^−/− compared with Stat1^+/− or Stat1^+/+ backgrounds. Together, these data support the model that enhanced megakaryopoiesis and elevated platelets in JAK2-V617F–driven MPN on Stat3 deletion could be mediated by increased Stat1 activity.

Stat3 deletion did not alter the hemoglobin levels in SclCre;V617F mice, but the polycythemia vera phenotype was attenuated by the loss of Stat3 in the MxCre;V617F model (supplemental Figure 1). The latter finding could be explained by the activation of Stat1, as increased erythropoiesis was observed in the SclCre;V617F mice on loss of Stat1.⁸  However, we also observed a decrease in the copy number in MxCre;V617F;Stat3^fl/fl mice compared with MxCre;V617F;Stat3^+/+ (supplemental Figure 6), which could also contribute to the normalization of the hemoglobin values. The JAK2-V617F copy number was retained on Scl-driven expression of the Cre recombinase, whereas repeated pIpC injections in MxCre mice decreased the number of JAK2-V617F copies, leading to lower JAK2-V617F/Jak2 ratio and the occurrence of an essential thrombocythemia-like phenotype, as previously reported.^16,25 

Acute enterocolitis resembling Crohn's disease with neutrophil infiltrates was first reported in Tie2Cre;Stat3^fl/fl mice and later confirmed also in MxCre;Stat3^fl/fl mice after pIpC induction.^26,27  Some of the mice that received bone marrow transplants from MxCre;STAT3^fl/fl mice with WT Jak2 also displayed inflammation and infiltration with neutrophils in the intestine, but recipients of SclCre;STAT3^fl/fl bone marrow did not show this phenomenon. Furthermore, we did not observe enterocolitis in JAK2-V617F transgenic mice after Stat3 deletion. Thus, enterocolitis in our mice appears to be less prominent than in the published nontransplanted Stat3-deficient mouse models, suggesting that loss of Stat3 in nonhematopoietic tissues may also contribute to the inflammatory state. Decreased survival of SclCre;V617F mice compared with MxCre;V617F mice has been already reported previously,²⁵  but the mechanisms responsible for these differences have not been determined. Survival of the JAK2-V617F mice was further shortened by the loss of Stat3 in both the MxCre and SclCre mouse models (Figure 1; supplemental Figure 1). This suggests that targeting Stat3 by inhibitors may have undesired adverse effects. The reason for the decrease in survival is not clear and does not appear to be primarily due to the inflammatory bowel disease, which in our transplanted mice was not very prominent.

Neutrophilia was reported in MxCre;Stat3^fl/fl mice after pIpC induction and in Tie2Cre;Stat3fl/fl mice.^27,28  Using SclCre and MxCre bone marrow transplantation models, we did not observe changes in neutrophil blood counts in Stat3-deficient mice on a WT Jak2 background and deletion of Stat3 in JAK2-V617F transgenic mice in contrast even normalized the neutrophil counts. An important difference between our study and the previous reports is that the Stat3 knockout, due to bone marrow transplantation in our study, was limited to hematopoietic cells only, whereas in the 2 previous studies, Stat3 was also deleted in nonhematopoietic cells. Thus, the differences in granulopoiesis may be due to presence or absence of Stat3 deletion in nonhematopoietic cells.

In conclusion, deletion of Stat3 in hematopoietic cells enhanced JAK2-V617F–driven thrombocytosis potentially due to the increase in Stat1 expression and activation. Targeting Stat3 in hematopoietic tissue reduced survival in MPN mouse models.

The authors thank Laurent Brault, Francois Duong, Pontus Lundberg, and Jürg Schwaller for helpful discussions and comments on the manuscript.

This work was supported by Swiss National Science Foundation grants 310000-120724/1 and 32003BB_135712/1 and Swiss Cancer League grant KLS-2950-02-2012 (to R.C.S.).

Contribution: J.G. designed research, performed research, analyzed data, and wrote the paper; T.S., A.D., L.K., and H.H.-S. performed research and analyzed data; S.D. prepared and analyzed histology samples; and R.C.S. designed research, analyzed data, and wrote the paper.

Conflict-of-interest disclosure: The authors declare no competing financial interests.

Correspondence: Radek C. Skoda, Department of Biomedicine, Experimental Hematology, University Hospital Basel, Hebelstrasse 20, 4031 Basel, Switzerland; e-mail: radek.skoda@unibas.ch.