Bis-indols: a novel class of molecules enhancing the cytodifferentiating properties of retinoids in myeloid leukemia cells

Acute promyelocytic leukemia (APL) is a form of acute myelogenous leukemia with typical chromosomal translocations leading to the expression of abnormal fusion proteins involving the nuclear retinoic acid receptor (RAR) α.1 These fusion proteins act as oncogenes and are responsible for the differentiation block and the expansion of the leukemic clone.1 In the majority of APL patients, the translocation involves chromosomes 15 and 17 and leads to the synthesis of promyelocytic leukemia (PML)–RARα.1 APL is the object of intense study, as it represents the only example of neoplastic disease that can be treated with a cytodifferentiating approach.2 APL patients are induced into clinical remission with all-transretinoic acid (ATRA),3 which forces the leukemic blast to acquire many of the characteristics of the terminally differentiated neutrophil. These include a short lifespan and the propensity to undergo a natural process of programmed cell death or apoptosis.4 

Although the success obtained with APL patients has raised enthusiasm for the clinical use of ATRA in the treatment of leukemia and other neoplastic diseases, the therapeutic efficacy of this compound is still burdened by problems such as resistance5 and toxicity.6 7 One possible strategy to increase the therapeutic index of ATRA is the development of ATRA-based pharmacologic combinations that are more powerful and easily tolerated than the individual components.

Relevant aspects of the differentiation program set in motion by ATRA in APL cells can be reproduced in primary cultures of leukemic blasts and in the derived NB4 cell line,8,9 which is a unique model for the study of the pharmacologic activity of ATRA and derivatives.10-12 Pharmacologic concentrations of ATRA arrest the growth of NB4 blasts and differentiate them into cells that resemble mature neutrophils.13,14 This is followed by a slow process of apoptosis.15 We and others used NB4 cells to demonstrate that such diverse compounds as cytokines, cyclic adenosine monophosphate (cAMP) analogs, and STI57116-20enhance the pharmacologic activity of ATRA and other retinoids.

In this report, we identify a novel class of compounds capable of potentiating the cytodifferentiating activity of ATRA in NB4 cells. These molecules have a bis-indol structure and enhance the efficacy of ATRA not only in vitro but also in vivo in the APL model of the severe combined immunodeficiency (SCID) mouse receiving transplants of NB4.21 22 

We used ATRA (Sigma, St Louis, MO), AM580,23 CD2915, and CD280915 (CIRD-Galderma Research and Development, Sophia Antipolis, France), U0126, PD169316, and SP600125 (Calbiochem, La Jolla, CA). ST1707, ST1346, ST1422, ST1860, ST1381, ST1730, ST1350, ST1866, ST1371, ST1385, ST1345, and ST1750 were synthesized by Sigma-Tau Industrie Farmaceutiche Riunite S.p.A.

NB4,9 NB4.306,24 U937, Kazumi, HL-60, KG1 (American Type Culture Collection [ATCC], Rockville, MD), and PR9 (a U937-derived cell clone expressing PML-RARα upon induction with zinc sulfate25) cells were cultured in the presence of RPMI 1640 with 10% fetal calf serum (FCS) (20% FCS in the case of Kazumi). COS-7 cells (ATCC) were grown in Dulbecco modified Eagle medium containing 10% FCS. Cells were free from mycoplasma contamination (Hoechst 33258 staining method).

COS-7 cells were transfected with cationic liposomes carrying plasmids for RARα and retinoid X receptor (RXR)α in the presence of the TRE-TK-Luc reporter gene and the normalization plasmid pCH110 (containing bacterial β-galactosidase), as described.23 26 

Cell number and viability were determined following staining with erythrosin (Sigma).27 CD11b, CD38, CD14, ICAM-1, and integrin α-5 were measured by flow cytometry using specific monoclonal antibodies (Becton Dickinson, Franklin Lakes, NJ).28 The nitrobluetetrazolium (NBT) reduction assay was performed on extracts of phorbol myristate acetate–stimulated cells,20 and the percentage of NBT⁺ cells was determined as described.20 

Extracts of NB4 cells (from 3 × 10⁶cells) were subjected to Western blot analysis as reported.20 The experiments were performed with antibodies against RARα (RPαF'),29 RXRα, 4RX1F6,30 CEBPε (C-22; Santa Cruz Biotechnology, Santa Cruz, CA), signal transducers and activators of transcription-1 (STAT1) p91 (C-24; Santa Cruz Biotechnology), STAT1 p91 and p84 (C-136; Santa Cruz Biotechnology), Tyr701 phosphorylated STAT1 p91 and p84 (Upstate Biotechnology, Lake Placid, NY), cathepsin D (C-20; Santa Cruz Biotechnology), tyk-2 (C-20; Santa Cruz Biotechnology), Mlh1 (C-20; Santa Cruz Biotechnology), or βactin (C-11; Santa Cruz Biotechnology). The antibodies directed against the phosphorylated forms of extracellular signal-regulated kinase-1 (ERK-1), ERK-2, Jun N-terminal kinase (JNK), and p38, and against histone H3 and its acetylated form were from Cell Signaling Technology (Beverly, MA). Protein bands were visualized with the enhanced chemiluminescence detection kit (Amersham, Little Chalfont, United Kingdom). JNK kinase activity was determined on JNK immunoprecipitates with c-JUN as a substrate, using a commercial kit (Cell Signaling Technology).

Enzyme-linked immunosorbent assays (ELISAs) (Endogen, Woburn, MA31) were used for the determination of interleukin-1 (IL-1), tumor necrosis factor (TNF), and monocyte chemoattractant protein 1 (MCP-1). Gel retardation assays were performed on nuclear extracts of NB4 cells, as already described.27 The following double-strand oligonucleotide probes (Santa Cruz) were used:CREB = 5′GAGAGATTGCCTGACGTCAGAGAGCTAG 3′; and Ets-1 = 5′GGATCTCGAGCAGGAAGTTCGA 3′.

RNA was extracted with the TRIzol reagent (Invitrogen SRL, S. Giuliano Milanese, Italy) and the polyadenylated fraction selected with the Atlas Pure kit (Clontech, Palo Alto, CA). The human 1.2 ATLAS nylon filters (Clontech) were used for the microarray experiments. Single-strand ³²P-labeled cDNA probes were synthesized from poly(A⁺) RNA as suggested by the manufacturer. Video imaging was performed with the Storm 860 Phosphorimager (Molecular Dynamics, Sunnyvale, CA). Microarray data were quantitated with the ATLAS IMAGE 2.0 analysis software (Clontech).

The in vivo experiments were carried out as described.22 Cells were suspended in 199 Hanks Medium, and 0.1 mL (1 × 10⁶ cells per mouse) were intraperitoneally inoculated in SCID mice. ST1346 was dissolved in Cremophor/ethanol 1:1 solution, diluted 1:4 in phosphate-buffered saline at the concentrations of 15 and 30 mg/kg, respectively. ATRA (Sigma) was dissolved in carboxy methyl cellulose (CMC) 0.5% + 0.01% Tween 80 solution at the concentration of 5 mg/kg. Drugs were administered intraperitoneally in a volume of 10 mL/kg one day after the inoculation, and the treatment continued for 3 weeks (5 daily injections per week.

A screening process based on the APL-derived NB4 cell line and aimed to select compounds that potentiate the cytodifferentiating activity of ATRA resulted in the identification of a novel class of agents with bis-indolic structures (BISINDs). As exemplified for the prototypical compounds ST1346 and ST1707 in Figure1, when NB4 cells are exposed to micromolar concentrations of BISINDs for 3 days, no significant effect on the growth, viability, or differentiation of the leukemic blasts is observed. However, when cells are simultaneously exposed to suboptimal concentrations of ATRA (0.1 μM) and ST1346 or ST1707, NBT-reducing activity (NBT-R), a myeloid differentiation marker,32 is enhanced in a dose-dependent manner. Combinations of ATRA and ST1346 or ST1707 are no more effective than the retinoid alone in terms of growth inhibition. In our experimental conditions, cell viability is always above 80% and is not affected by any treatment.

To get insight into the structural determinants responsible for the pharmacologic activity of BISINDs, we evaluated 12 congeners (Table1). No molecule in the series increases NBT-R, regardless of the concentration used. However, ST1707, ST1346, ST1422, and ST1860 significantly enhance the induction of NBT-R afforded by ATRA (0.1μM). ST1381 causes a much lower effect, whereas ST1730, ST1350, ST1866, and ST1371 are devoid of any potentiating action. Significantly, ST1385, ST1345, and ST1750 inhibit ATRA-dependent induction of NBT-R. In the presence of a fixed concentration of ATRA (0.1μM), the AC₅₀ values for the potentiating effect vary from 0.3 μM in the case of ST1381 to 8.2 μM in the case of ST1422. The relative potency of each BISIND was calculated at 10 μM (except for ST1730) and results in the rank order: ST1707 > ST1346 > ST1422 > ST1860 > ST1381. In the absence of ATRA, all the compounds are devoid of significant antiproliferative effects. With the exception of ST1730, all the BISINDs are cytotoxic only at concentrations that are significantly above their corresponding AC₅₀. A first analysis of structure/activity relationships indicates that the bis-indol is strictly required for the observed pharmacologic activity (Table 1; data not shown). Attempts to identify other determinants of the potentiating activity of BISINDs suggest that the alkyl chain bound to the carbon bridging the 2 indol rings and the terminal carboxylic group are important.

We focused our attention on ST1346. Figure2 demonstrates that treatment of NB4 cells with ST1346 enhances ATRA-induced NBT-R time dependently (panel A). Potentiation is observed also in terms of the number of NBT-R⁺ cells, which is significantly higher following 3 days of treatment with ATRA + ST1346 than with ATRA alone (panel B). This demonstrates that the BISIND accelerates the process of granulocytic maturation activated by ATRA. The growth curve of NB4 blasts observed in control conditions is not altered by ST1346 (panel C). Similarly, the growth arrest of the leukemic cells triggered by ATRA is not significantly affected by the BISIND. The level of cell viability is higher than 85% in all the experimental conditions considered.

Figure 3A shows that the enhancing effect of ST1346 on ATRA-induced stimulation of NBT-R is already visible at the retinoid concentration of 0.01μM and is maintained at higher concentrations. Potentiation is not the result of a priming effect of ATRA or ST1346 on NB4 cells because continuous treatment with both compounds is necessary. As shown in Figure 3B, pretreatment of NB4 cells with ST1346 for one day followed by washing with fresh medium and incubation with the retinoid for 3 days causes an induction of NBT-R that is significantly lower than that observed following continuous treatment for 4 days with the combination of ST1346 + ATRA. Changing the order of addition of ST1346 and ATRA or extending the pretreatment period to 3 days results in similar effects. Figure 3C shows that ST1346-dependent potentiation is observed in the retinoid-sensitive NB4 parental cell line, but not in the retinoid-resistant NB4.306 subline.24 Figure 3D demonstrates that the cytodifferentiating effect of ST1346 + ATRA is evident also in the myeloid leukemia cell line, PR9, which is engineered to allow conditional expression of the APL oncogene PML-RARα.25 However, induction of the oncogene by zinc sulfate (data not shown) in PR925 does not result in an increase of NBT⁺ cells, which is significantly different from that observed in the absence of the inducing agent. These data suggest that PML-RARα is not strictly necessary for the ST1346 + ATRA–mediated cytodifferentiating response. Nevertheless, we cannot formally exclude the possibility that PML-RARα has some effect on the interaction, given a certain level of leaky expression of the oncogene in uninduced PR9 cells. As shown in Figure 3E-H, we extended our analysis to 4 other PML-RARα⁻ myeloid leukemia cell types, that is, the myelocytic HL-60, the myelomonoblastic U937, and Kazumi, as well as the myeloblastic KG1 cell lines. Treatment of the ATRA-sensitive HL-60 blasts with increasing concentrations of ST1346 and a suboptimal concentration of ATRA leads to significant induction of NBT-R. In this case, maximal induction of NBT-R is observed following addition of 50 μM ST1346 to ATRA. In the experimental conditions used, U937 and Kazumi cells are refractory to challenge with ATRA, while the combination of ST1346 + ATRA causes a variable proportion of both cell populations to become NBT positive. It is worth noticing that maximal induction of NBT positivity in Kazumi cells by ST1346 + ATRA is observed at 2 different concentrations of the BISIND (10 and 50 μM) and takes longer than in other cell types. KG1 is totally unresponsive to both ATRA and the combination of the bis-indol and the retinoid.

In NB4 cells, ST1346 enhances the cytodifferentiating activity not only of ATRA but also of AM580, a synthetic and selective RARα/PML-RARα agonist.23 As illustrated in Figure4, the BISIND (5 μM) augments the level of NBT-R induced by AM580 (0.001 and 0.01 μM) significantly. ATRA cannot be substituted by the RXR agonists CD2915 and CD2809. The small NBT-R–inducing effect caused by ST1346 and the highest concentrations of CD2915 (1 μM) is due to the residual RAR agonistic activity associated with the retinoid. In fact, a similar phenomenon is not observed in the case of the combination ST1346 + CD2809.

We established whether the potentiating activity of ST1346 affects the levels of the myeloid CD11b and the monocytic CD14 markers. A typical fluorescence-activated cell-sorter profile of CD11b in NB4 cells treated for 3 days with ATRA (0.01 μM), ST1346 (5 μM), or the combination of the 2 compounds is shown in Figure5A. A small proportion of NB4 cells is positive for CD11b in basal conditions and following challenge with the BISIND alone. ATRA increases both the number of CD11b⁺cells and CD11b cell–associated fluorescence, and these effects are enhanced by ATRA + ST1346. As illustrated in Figure 5B, an increase in the number of CD11b⁺ cells is evident at ATRA concentrations of 0.001 μM and 0.01 μM and is lost at 0.1 μM (left panel). This is expected, as 0.1 μM ATRA induces expression of CD11b practically on almost all the NB4 cell population. Significantly, however, even at the highest concentration of the retinoid, the amount of CD11b cell–associated fluorescence is higher following challenge with ATRA + ST1346 than with ATRA alone (right panel). None of these effects is evident in the case of CD38, which is maximally induced by ATRA and not further enhanced by ST1346. Treatment of NB4 cells with ATRA or ATRA + ST1346 does not result in the appearance of CD14⁺cells.

To identify the genes modulated in NB4 cells by ST1346 alone or in combination with ATRA, we analyzed the expression of approximately 1200 genes with cDNA microarrays. We focused on genes expressed either early (8 hours) or relatively late (3 days) along the granulocytic maturation process, and the results are summarized in Table2. We observed 38 genes induced by ATRA. The expression of 20 of these genes is enhanced by cotreatment with ST1346 for either 8 or 72 hours (group A). Among the products of these genes, the myeloid nuclear cell differentiation antigen, intercellular adhesion molecule-1 (ICAM-1), MCP-1, migration inhibitory factor–related protein (MRP)–14, MRP-8, and granulocyte colony-stimulating factor (G-CSF) receptor are known myeloid differentiation markers. For some genes in group A (PRK1, G-CSF receptor, LIM-kinase, LD-78, c-fgr, and Tyk-2), the combination of ATRA + ST1346 maintains increased expression for a longer time than ATRA alone. For other genes (MAPKAP-K2 and cathepsin D), treatment of NB4 cells with the retinoid and the BISIND accelerates the up-regulation observed in the presence of ATRA. The remainder of genes whose expression is induced by ATRA is not further up-regulated by the addition of ST1346 to the medium (group B). Indeed, in some cases, the BISIND inhibits the induction of gene transcription afforded by the retinoid (P19INK, TNF receptor, RALB, etc). Group C consists of 10 genes that are activated only following treatment of NB4 cells with ATRA + ST1346. The majority of these genes are turned on at 8 hours, and increased activity is either maintained or turned off at 72 hours. Paradoxically, however, the steady-state levels of the transcripts encoding human DNA replication licensing factor (hRlf) beta subunit, vascular endothelial growth factor (VEGF), and classical late-infantile neuronal ceroid lipofuscinosis (CLN2) show a biphasic pattern of expression upon treatment with ATRA + ST1346, that is, an increase at 8 hours and a decrease at 72 hours.

Group D is composed of the genes coding for cathepsin C, heat shock factor 1, and replication factor C, which are activated by ST1346 alone. Group E consists of 19 genes whose expression is significantly down-regulated by ATRA and includes those coding for the 2 cytokines IL-1 and TNF. Finally, group F includes 3 genes, ARF1, DNA polymerase Delta, and M-CSF, whose level of expression is significantly down-regulated only by ATRA + ST1346.

For a number of genes in Table 2, we measured the relative protein or RNA products. Flow cytometric analysis of ICAM-1 demonstrates that more than 90% of the undifferentiated NB4 blasts express the adhesion molecule. As shown in Figure 6A, ST1346 (10 μM) does not alter the levels of cell-associated ICAM-1, whereas ATRA augments it in a dose-dependent manner. Cotreatment of NB4 cells for 3 days with the BISIND and ATRA enhances the surface expression of ICAM-1 by approximately 2-fold at both the concentrations of the retinoid considered. By contrast, ATRA and ATRA + ST1346 are equally efficient in up-regulating integrin α4. As illustrated in Figure 6B, the combination of the BISIND and ATRA is more effective than the retinoid alone in inducing the mutL homolog 1 (Mlh-1) DNA repair protein, the protease cathepsin D, and the tyrosine kinase Tyk-2. A similar situation is observed in the case of the mRNAs encoding the transcription factor Id-2 and the myeloid nuclear differentiation antigen (data not shown). The most dramatic example of the positive interaction between ST1346 and ATRA is represented by the chemokine MCP-1. Following treatment with ATRA, NB4 cells secrete detectable amounts of MCP-1 (Figure 6C). At 3 days, the levels of secreted chemokines are increased approximately 6-fold by ATRA + ST1346. We also evaluated the secretion of the 2 cytokines TNF and IL-1, whose mRNAs are down-regulated by ATRA and the combination of ST1346 and ATRA (Table 2). Figure 6C demonstrates that undifferentiated NB4 cells secrete measurable amounts of TNF and IL-1. Both ST1346 and ATRA reduce the secretion of the 2 cytokines. In the case of IL-1, this effect is significant at day 1 and is maximal at day 3. Given the low levels of TNF already observed following treatment with the BISIND or ATRA, it is difficult to establish whether the combination of BISIND + ATRA is more effective than the single components in inhibiting the secretion of the 2 cytokines. By contrast, inhibition of IL-1 secretion by ATRA + ST1346 is not significantly different from that afforded by ST1346 or ATRA alone.

NB4 blasts express significant amounts of both RARα and PML-RARα, and transfection of this cell line is technically challenging. Thus, the effect of ST1346 on the trans-activating properties of RARα, PML-RARα, or RXRα was investigated in COS-7 cells, which are endowed with relatively low levels of nuclear retinoic acid receptors23 and easily transfected. As illustrated in Figure 7A, following cotransfection with a void plasmid (pSG5) and TRE-TK-Luc (containing a luciferase reporter gene controlled by a retinoid-dependent artificial promoter), treatment of cells with ATRA results in an approximately 5-fold increase in the levels of luciferase activity relative to what is observed in basal conditions. This effect is explained by the presence of endogenous retinoic acid receptors in COS-7 cells. ST1346 has no significant effect on either the basal or the ATRA-induced levels of luciferase activity. Forced expression of RARα RXRα RARα RXRα, and PML-RARα (data not shown) increases the ATRA-dependent induction of luciferase activity to varying degrees. Again, ST1346 has no significant effect on the ligand-dependent or independent trans-activating properties of the various receptors. Varying the concentrations of ATRA and ST1346 or changing the type of recipient cell lines and reporter constructs does not alter the results (data not shown). Although our data do not rule out possible specific effects related to the myeloid cell context, they suggest that ST1346 does not modulate the transcriptional activity of RARα or PML-RARα complexes directly.

Treatment of APL blasts with ATRA is associated with degradation of both PML-RARα and RARα.33 Furthermore, ATRA-triggered granulocytic maturation is accompanied by down-regulation of the transcript encoding RXRα.34 As illustrated in Figure 7B, treatment of NB4 cells with the retinoid for 72 hours results in the disappearance of the protein band corresponding to PML-RARα and in a substantial decrease in the steady-state levels of the RARα polypeptide. This phenomenon is left unaffected by addition of ST1346 to the medium. Similarly, ST1346 does not exert any effect on the RXRα protein, which is synthesized in significant amounts by undifferentiated NB4 cells and down-regulated by ATRA treatment. Finally, as shown in Figure 7C, ST1346 is not a general inducer of histone acetylation, a phenomenon associated with the transcriptional activation of retinoic acid receptors and stimulated by agents such as sodium butyrate.35 36 

Various types of transcriptional factors, including the STAT1 and CEBPε proteins as well as the ets and cAMP-dependent CREB binding complexes, are implicated in the process of APL blast differentiation activated by ATRA.37-40 As expected37 and as illustrated in Figure 8A (left panel), treatment of NB4 cells for 3 days with ATRA causes a significant increase in the amounts of STAT1α (91 kDa) and STAT1β(84 kDa). ST1346 enhances the ATRA-dependent induction of both forms of STAT1 (left panel). A quantitative assessment of the enhancing effect of ST1346 on the ATRA-dependent induction of STAT1α demonstrates that the BISIND causes a 3-fold induction of the protein over what is observed in the presence of the retinoid alone (right panel). At least a proportion of the ATRA- and ST1346 + ATRA–induced STAT proteins must be in the transcriptionally active state, as indicated by the level of phosphorylation of Tyr701 (left panel). As shown in Figure 8B, CEBPε is not synthesized by undifferentiated NB4 cells. Following ATRA treatment, significant amounts of CEBPε are already evident at 12 hours and increase up to 72 hours. ST1346 treatment does not result in the synthesis of the CEBPε protein and has only marginal effects on the level of induction afforded by the retinoid. Figure 8C demonstrates that nuclear extracts of undifferentiated NB4 cells contain detectable amounts of CREB and Ets-1complexes, as assessed by gel retardation assays. Treatment of cells for 4 hours with ST1346, but not ATRA, results in the disappearance of the Ets-1 complex. This inhibitory effect is completely suppressed if cells are simultaneously exposed to ST1346 and ATRA. ST1346-dependent inhibition disappears following 16 hours of culturing. By this time, NB4-associated Ets-1 binding activity is similar in all the experimental conditions considered. In the case of CREB, ATRA reduces the amounts of the specifically retarded band observed in control conditions at both 4 and 16 hours. This effect is reversed by addition of ST1346 to the culture medium.

MAP kinases, ERK, p38, and JNK are involved in the process of differentiation of myeloid cells.41-44 As illustrated in Figure 9A, undifferentiated NB4 cells show high levels of constitutive ERK phosphorylation. The predominant form of phosphorylated ERK is p42. Treatment of cells with ATRA, ST1346, and the combination of the 2 compounds for 8 or 72 hours does not affect the steady-state levels or the phosphorylation of ERK p42 and p44 proteins. As shown in Figure 9B, in conditions of complete suppression of ERK activation (data not shown), the MEK inhibitor U0126 does not affect the proportion of NBT⁺ NB4 cells nor the level of cell-associated NBT-R activity observed following treatment with vehicle, ATRA, ST1346, or ATRA + ST1346. This indicates that constitutive ERK phosphorylation and activation do not play any significant role in the process of granulocytic maturation activated by ATRA and enhanced by ST1346.

Figure 9C demonstrates that NB4 cells express detectable amounts of p38 protein, and the quantity of the polypeptide is not altered by any of the treatments considered. Following 72 hours of challenge, ATRA increases p38 phosphorylation. ST1346 has no detectable effect on the ATRA-induced level of p38 phosphorylation. Figure 9D demonstrates that the specific p38 inhibitor PD169316 enhances the induction of NBT-R activity observed in the presence of ATRA. Interestingly, addition of the inhibitor to ST1346 and ATRA results in a level of NBT-R activity that is slightly but significantly higher than that observed in the presence of the combination of the BISIND and the retinoid. Altogether, our results indicate that activation of p38 plays a negative role in the process of granulocytic maturation of APL cells. However, they suggest that enhancement of NB4 cell differentiation by ST1346 does not involve p38 inhibition.

As shown in Figure 9E, 2 forms of JNK, p46 and p54, are synthesized by undifferentiated NB4 cells. Both forms are phosphorylated in basal conditions, although the level of p54 phosphorylation is higher than that of p46. Following 8 or 72 hours of treatment with ATRA, ST1346, or the combination of the 2 compounds, no significant variation in the amounts of p46 and p54 are observed. At 8 hours, the level of p46 or p54 is similar in all the experimental groups considered; at 72 hours, ATRA inhibits JNK phosphorylation. This down-regulation is relieved in cells treated with ATRA + ST1346. As expected and as illustrated in Figure 9F, inhibition of JNK phosphorylation by ATRA is associated with a decrease in the corresponding c-JUN kinase activity. JNK activity is brought back to control levels by the combination of ST1346 + ATRA. Treatment of NB4 cells with the JNK inhibitor SP600125 blocks JNK activity in all the experimental conditions considered. This is accompanied by a decrease in the percentage of NBT-R–positive NB4 cells observed upon challenge with ATRA + ST1346 to a level similar to that observed following treatment with ATRA alone. The effect is evident not only in terms of the number of NBT-R–positive cells but also in terms of cell-associated enzymatic activity. Thus, prolonged JNK activation by ATRA + ST1346 may be crucial for the enhancement of the retinoid cytodifferentiating effect by the BISIND.

To evaluate whether the potentiating effect of ST1346 on ATRA cytodifferentiating activity has an impact on the therapeutic efficacy of the retinoid, we performed experiments in SCID mice that received transplanted NB4 cells intraperitoneally.22 As shown in Table 3, treatment of animals with a suboptimal dose of ATRA (5 mg/kg) or 2 doses of ST1346 (15 and 30 mg/kg) does not cause a significant increase in the mean survival time (MST). Coadministration of ST1346 and ATRA results in an increase of MST, which is statistically significant at the higher dose of BISIND. The effect on MST and increased lifespan (ILS) obtained with ATRA + ST1346 (30 + 5 mg/kg) is similar to that observed with a maximally tolerated dose of ATRA (15 mg/kg) (data not shown). No dosage regimen is accompanied by significant toxicity as determined by the lack of body weight loss and by the absence of toxic deaths. These results suggest that enhancement of ATRA-induced cytodifferentiation by BISIND can be exploited to increase the in vivo efficacy of the retinoid.

Here, we report on the identification of a novel class of experimental agents, BISINDs, that potentiate the cytodifferentiating activity of ATRA in APL and other acute myeloid leukemia (AML) cells. The BISIND prototypical molecule ST1346 exerts a general stimulating effect on many aspects of the granulocytic maturation program set in motion by ATRA. The potentiating effect of ST1346 is specifically directed toward ATRA-induced cytodifferentiation, as the compound leaves unaltered the antiproliferative and apoptogenic activity of the retinoid. Administration of ST1346 to SCID mice xenografted with NB4 cells dose-dependently stimulates the therapeutic effect of an otherwise ineffective dose of ATRA and significantly increases the lifespan of leukemia-bearing animals. These results are consistent with the fact that enhancement of the cytodifferentiating potential of ATRA is a viable strategy to increase the in vivo therapeutic efficacy of the retinoid.

As ATRA acts predominantly through modulation of target gene expression, we established the number and type of ATRA-responsive genes regulated by ST1346. Profiling of NB4 gene expression with microarrays demonstrates that the BISIND enhances and/or prolongs the ATRA-dependent up-regulation of a number of gene products. Approximately 3% of the mRNAs analyzed are significantly up-regulated by ATRA either early and/or late during the granulocytic maturation process. The expression levels of about one half of these transcripts are enhanced by coincubation of the cells with ATRA + ST1346. The list includes mRNAs coding for myeloid differentiation markers (MRP-8, MRP-14, MCP-1, G-CSF–receptor, and ICAM-1), transcription factors (Id-2, IRF-7, and Net), signal transducers (c-raf, Tyk-2, protein kinase C–related 1 (PRK-1), LIM-kinase, and LD78 guanosine 5′-triphosphate [GTP]-binding protein), and a miscellaneous group of proteins among which the microtubule-associated protein EB1 and the integrin ICAM-1 stand out.

In the conditions of the microarray experiments, the effect of ST1346 on genes negatively regulated by ATRA is difficult to determine, because the expression of most of them is already turned off by the retinoid. Nevertheless, in the case of the limited number of ATRA down-regulated genes for which we have data on the respective protein products, we observed significant interactions between the retinoid and the BISIND. Decreased secretion of the proinflammatory cytokines TNF and IL-1 by ATRA and/or ST1346 may be of clinical relevance, as these types of products are causally related to the life-threatening ATRA syndrome.45 

The results obtained with microarrays highlight another important point, that is, there are genes neither responsive to ATRA nor to ST1346 that are significantly induced by ATRA + ST1346. Among these, the Na⁺/H⁺ antiporter APNH1 may be of some functional relevance, as changes in the intracellular pH have been associated with the process of granulocytic maturation.46 

ST1346 modulates the level and the state of activation of some transcription factors potentially involved in the granulocytic maturation of leukemic blasts. ATRA increases the steady-state levels of STAT1, and this effect is preceded by a transient activation of the protein by tyrosine phosphorylation.37 STAT1 activation and induction are responsible for the increased expression of interferon-responsive genes, such as the IRF1,37 which plays a role in myeloid differentiation. ST1346 enhances the ATRA-dependent induction of activated STAT1, demonstrating that this transcription factor is one of those retinoid-modulated genes that is responsive to the BISIND. The observed up-regulation of the Id-2 transcript by ATRA and its further stimulation by ST1346 and ATRA may also be of interest in this context. Id-2 is a helix-loop-helix (HLH) transcriptional factor with inhibitory effects on the activity of other HLH.47 Most importantly, ST1346 prevents the down-modulation of the CREB transcription complex afforded by ATRA, through an as-yet-unknown mechanism. CREB complexes (cAMP-responsive element binding complexes) can be activated by the cAMP-dependent protein kinase A. The cyclic nucleotide, the corresponding kinase, and the downstream transcriptional factors are permissive determinants of APL differentiation.18,19 48Hence, sustained CREB activation may favor ATRA-induced granulocytic maturation.

The primary molecular targets underlying the pharmacologic activity of BISINDs are still unknown. However, the data obtained in COS-7 cells are not consistent with any direct effect of ST1346 on the transcriptional activity of RARα or PML-RARα (Figure 7). In addition, contrary to 2 other retinoid sensitizers like ST157120 and sodium butyrate,36 ST1346 does not inhibit the degradation of RARα or PML-RARα and is not a general activator of histone acetylation.

Because MAP kinases play a major role in the processes of cell growth and differentiation of various cell types,41-44 we focused our attention on ERKs, p38, and JNKs. As to the first family, prolonged activation of ERKs has been associated with ATRA-induced granulocytic maturation of HL-60 cells.49 In NB4 cells, we demonstrate that ERKs are constitutively phosphorylated and activated. ATRA, ST1346, and the combination of the 2 compounds do not alter the level of ERK phosphorylation. Furthermore, inhibition of ERK phosphorylation with the selective MEK inhibitor U0126 has no impact on the cytodifferentiating effects of ATRA or its combinations with ST1346. This indicates that constitutive ERK activation is not a prerequisite for ATRA-induced granulocytic maturation of APL cells and demonstrates that the enzymatic system is not involved in the potentiating action of ST1346.

As to the second family, ATRA treatment of NB4 cells results in long-term phosphorylation of p38, which is not further enhanced by ST1346. Since p38 inhibition stimulates ATRA-dependent granulocytic maturation of HL-60 cells,50 it is not surprising that we observed a similar effect in PD169316-treated NB4 cells. Moreover, when the p38 inhibitor is present in the culture medium along with ST1346 and ATRA, the level of the myeloid differentiation marker, NBT-R activity, is slightly but significantly higher than following treatment with ATRA + ST1346 or ATRA + PD169316. Thus, although activation of p38 seems to play a negative role in the process of ATRA-induced granulocytic maturation, the enhancing effect of ST1346 is likely to be independent of p38 activity.

As to JNKs, the third family of MAP kinases, they are involved in many cellular processes.51,52 JNKs activate the AP1 transcriptional complex,53 and ATRA represses AP1 activation in part by acting on JNKs.53,54 These phenomena may have relevance in terms of APL cell growth and maturation, as the 2 processes are tightly associated.15 Our data indicate that ATRA causes a late suppression of the constitutive level of JNK phosphorylation. The phenomenon is relieved by ST1346, which reinstates levels of JNK phosphorylation similar to those observed in basal conditions. This, along with the results obtained with the JNK inhibitor SP600125, indicates that activation of the kinase is necessary for ST1346 to enhance the cytodifferentiating effect of ATRA.

In conclusion, though, the primary molecular targets of BISINDs are unknown, and the biologic action is likely to be novel and may ultimately modulate the CREB and JNK intracellular pathways. Nevertheless, the in vitro and in vivo pharmacologic activity of this novel class of agents may be of clinical benefit in the treatment of APL and, perhaps, other types of AML. BISINDs may increase the therapeutic index of ATRA by reducing the dosage of the retinoid administered. In more general terms, given the low level of toxicity, ST1346 may find application in several settings where the chronic use of ATRA is called for, such as in chemoprevention of neoplasia.

We are thankful to Prof Silvio Garattini, Dr Mario Salmona, and Dr Anne Dejean (Institut Pasteur, Paris) for critical reading of the manuscript. We also thank Prof P. Chambon and Dr Cecile Rochette-Egly (Institut de Genetique et de Biologie Moleculaire et Cellulaire [IGBMC], Strasbourg, France) for the kind gift of anti-RAR antibodies. The help of Marina Sironi in the measurement of IL-1, TNF, and MCP-1 is also acknowledged. We thank Dr Michel Lanotte (Hopital St Louis, Paris, France), Dr Carlo Gambacorti-Passerini (Istituto Nazionale dei Tumori, Milano, Italy), and Dr Pier Giuseppe Pelicci (Istituto Oncologico Europeo, Milano, Italy) for the kind gift of the NB4, NB4.306, and PR9 cell lines.