Expression of tumor-suppressor genes interferon regulatory factor 1 and death-associated protein kinase in primitive acute myelogenous leukemia cells

The concept of a hierarchical organization to leukemic populations has been considered for many years,1,2 but only recently has the phenotypic description of leukemic stem cells allowed more direct analyses. Recent studies have shown that CD34⁺/CD38⁻ or CD34⁺/HLA-DR⁻ acute myelogenous leukemia (AML) cells are unique in their ability to initiate leukemic cell growth in long-term cultures or nonobese diabetic/severe combined immune-deficient mice.3-5 In addition, our own studies have recently shown that primitive AML cells can be distinguished from normal stem cells by virtue of strong CD123 expression.6 Thus, it is now possible to isolate pure populations of primitive AML cells for experimental analysis. Given the potentially critical role of leukemic stem cells in the pathogenesis of leukemic disease, we sought to identify genes preferentially expressed in primitive AML cells. Moreover, we were specifically interested in genes whose expression is conserved among different AML subtypes. Our rationale was that conserved genes may represent those most important to the underlying cause of stem cell transformation. Using this approach, we have identified 2 genes that are expressed in primitive AML cells of differing subtypes. Both genes, death-associated protein kinase (DAPK) and interferon regulatory factor 1 (IRF-1), are strongly associated with tumor- suppressor activity, and their expression is therefore not expected in malignant cells.7 8 We suggest that the presence of these factors may indicate previously uncharacterized features of AML biology.

AML blood and normal marrow cells were isolated and processed as previously described.6 

To isolate purified cells, primary AML or normal leukocytes were labeled with CD34- FITC and CD38- phycoerythrin (PE) (Becton Dickinson, San Jose, CA). Samples were sorted by means of a FACSVantage (Becton Dickinson, San Jose, CA) flow cytometer (typical purity, at least 95%). AML cells were also analyzed with CD123-PE (Pharmingen, San Diego, CA).

With the use of CD34⁺/CD38⁻ cells (0.5 to 1.0 × 10⁶ cells), total RNA was isolated by means of the NucleoSpin RNA II kit (Clontech, Palo Alto, CA), and probes were generated by means of the Atlas cDNA Expression Array kit (Clontech, Palo Alto, CA) as per manufacturer's instructions. Samples were hybridized (3 million to 5 million cpm) to Clontech Human Cancer 1.2 and Hematology arrays. Data from each array was analyzed by phospho-imager and quantitated by means of the Atlas Image 1.0 software. On the basis of the consistency of CD34 expression in both cell types, expression of all genes in the array is expressed in units relative to CD34 (intensity arbitrarily set = 1). Furthermore, serial probing of complementary DNA (cDNA) arrays with probes from the same specimen showed a high degree of consistency.

RNA samples were prepared with the use of the Miltenyi μMACS (Mitenyi, Auburn, CA) messenger RNA isolation kit according to the manufacturer's instructions and reverse transcribed with Superscript II (Gibco, BRL, Rockville, MD) via standard procedure. Polymerase chain reactions (PCRs) were performed by means of a PerkinElmer 9700 thermalcycler and the following primers:β2-microglobulin forward, CTCGCGCTACTCTCTCTTTC; reverse, CATGTCTCGATCCCACTTAAC. IRF-1 forward, CGGGGCTCATCTGGATTAATAAAGAGG; reverse, GGATGTGCCAGTCGGGGAGAGTG.DAPK forward, AAGCCATCATCCATGCCATC; reverse, TCTCTCCTTCTCGGTTCTTGA. For each reaction, the cDNA equivalent of 1000 cells was amplified for 30 cycles (94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds).

Cell samples were prepared and analyzed as previously described.6 The DAPK-55 antibody (Sigma, St Louis, MO) was used at a 1:500 dilution. IRF-1 was detected with the C-20 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000. All primary antibodies were visualized by means of alkaline phosphatase-conjugated secondary antibodies and the ECF reagent (Pharmacia, Sweden) according to the manufacturer's instructions.

The AML specimens analyzed were of French-American-British (FAB) subtypes M1 (n = 2), M2 (n = 1), M4 (n = 3), and M2/M6 (n = 1), which exhibited either normal or aberrant cytogenetics (footnote, Table1). It should be noted that in order to obtain sufficient CD34⁺/CD38⁻ cells for analysis, it was necessary to use AML specimens with a high white blood count (Table 1). A key issue in generating probes was to distinguish between leukemic and normal primitive cells that might be present together in a primary specimen. Each sample was derived from peripheral blood; therefore, the frequency of normal stem cells should be extremely low. However, a clearer definition of leukemic vs normal primitive cells can be obtained by analyzing expression of the CD123 antigen. Recently, we have shown that CD123 is preferentially up-regulated on leukemic, but not normal, CD34⁺/CD38⁻ cells.6 Each of the CD34⁺/CD38⁻ specimens used for this study was highly enriched for CD123⁺ cells (95% to 100% pure) (footnote, Table 1). Therefore, most, if not all, primitive cells were of leukemic origin.

CD34⁺/CD38⁻ cells sorted from each population were used to isolate RNA and synthesize ³²P-labeled cDNA probes. We analyzed 7 AML specimens in parallel with samples of normal CD34⁺/CD38⁻ cells. The cumulative results are shown in Table 1 and represent analysis of approximately 1400 known genes. The first 2 genes listed in Table 1, DAPKand IRF-1, were found to be overexpressed in all 7 of the AML samples examined. DAPK has been shown to be active as an inducer of apoptosis and is strongly implicated as a tumor-suppressor gene.7,9 Indeed, the gene is silenced in many malignant cell types, including some leukemic cell lines.10,11Similarly, the transcription factor IRF-1 has also been shown to be a tumor suppressor and is strongly induced by interferon-γ.8,12 Moreover, this gene is usually deleted or shows exon skipping in acute promyelocytic leukemia or leukemias with deletion of chromosome 5q31.13 Interestingly, DAPK was originally discovered by means of a genetic screen for interferon-γ–inducible apoptosis.14 Thus, we speculate that IRF-1 may directly activate expression of DAPK in AML cells.

To confirm the expression of DAPK and IRF-1, reverse transcription (RT)–PCR was performed on highly purified populations derived from AML and normal specimens. As shown in Figure 1A, expression of each gene was evident in CD34⁺/CD38⁻ cells from leukemic specimens, but was not seen in normal specimens. To further assess expression of each gene, immunoblots were performed. While it is not typically feasible to isolate sufficient CD34⁺/CD38⁻ cells for this type of analysis, it was possible to enrich for primitive cells by purifying the CD34⁺ population. As shown in Figure 1B, DAPK, and IRF-1 are readily detected in AML but not normal CD34⁺ cells.

In addition to DAPK and IRF-1, 5 genes potentially relevant to AML biology (Table 1, genes 3-7) were found to be overexpressed in 4 or more primary AMLs. Notably, 3 of these genes,AML-1, AF-4, andEWS, are known cancer-related genes. In particular, both AML-1 and AF-4 are associated with the common disruptions of CBF and MLL frequently found in myeloid leukemias.15-17 However, none of the samples assayed had the translocations associated with AML-1 and AF-4. Gene 6,Ikaros, is implicated in the development of early hematolymphoid cells and has also been reported to have aberrant activity in acute lymphoblastic leukemia (ALL).18,19 In addition, dominant negative forms of Ikaros have been reported in infant ALL with the MLL-AF4 translocation.20 A surprising finding was expression of Stat6 in several AML specimens. Transgenic studies have implicated Stat6 as critical for development and function of T_H2 lymphocytes,21but to our knowledge it does not have a known role in myeloid development or malignancy.

In summary, we have documented consistent overexpression of the tumor-suppressor genes IRF-1 and DAPK in primary AML cells with a primitive phenotype. These data are surprising in that pro-apoptotic factors are typically absent from malignant cells, and they thereby indicate that IRF-1 and DAPK may play a role in the biology of early leukemogenic cells. One interpretation of these results may be that leukemic cells undergo the beginnings of apoptotic induction, but clearly fail to complete the process of apoptosis. Thus, some proteins associated with apoptosis or tumor suppression are evident. We suggest that exploiting the presence of these molecules may be an interesting means of affecting programmed cell death in leukemic stem/progenitor cells.

The authors thank Drs Gary Van Zant and Stephen J. Szilvassy for helpful discussions and critical evaluation of the manuscript, and the National Disease Research Interchange for help in procuring normal bone marrow specimens.