NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15)

In myeloid malignancies several chromosomal translocations and corresponding chimeric genes have been identified between NUP98 at 11p15 and PMX1 at 1q23,HOXD13 at 2q31, NSD1 at 5q35, HOXA9 at 7p15, LEDGF at 9p22, DDX10 at 11q22, andTOP1 at 20q11.1-8 In lymphoid malignancies only a subset of T-cell acute lymphoblastic leukemia with a t(4;11)(q21;p15) and a NUP98-RAP1GDS1 fusion gene has been reported to date.9 

Chromosomal bands 8p11-p12 are involved in well-characterized leukemic syndromes, such as acute myeloid leukemia (AML) with erythrophagocytosis and t(8;16)(p11;p13.3)10and a chronic myeloproliferative disorder (CMPD) with eosinophilia, concomitant lymphoblastic leukemia–lymphoma, and t(8;13)(p11;q12).11 As a result of translocations,MOZ fuses with the CBP gene at 16p13.3 in AML, and FGFR1 rearranges with ZNF198 at 13q12 in the CMPD–lymphoma syndrome. Alternative recombinations withTIF2/8q13 and p300/22q13 for MOZ gene and with FOP/6q27 and CEP110/9q33 forFGFR1 have also been described.12-16 

We report the first patient with AML with recombination between the NUP98 gene and a new partner at 8p11.2, telomeric toFGFR1. NSD3 (nuclear receptor-binding su(var)3-9, enhancer of zeste, trithorax [SET] domain containing gene 3), also named WHSC1L1 (Wolf-Hirschhorn syndrome candidate-1–like-1), belongs to the same family asNSD1, whose mouse homolog is an RARα-interacting protein,17 and NSD2, named WHSC1(Wolf-Hirschhorn syndrome candidate-1) or MMSET(multiple myeloma SET domain).

A 65-year-old man was admitted because of fever and malaise. Clinical examination disclosed slight hepatomegaly. Hematologic data were as follows: hematocrit, 22%; hemoglobin level, 9 g/dL; leukocyte count, 159 × 10⁹/L with 84% blast cells, 5% promyelocytes, 3% myelocytes, 2% neutrophils, 2% basophils, 1% eosinophils, and 3% lymphocytes; platelet count, 81 × 10⁹/L. Bone marrow aspirate was indicative of AML, M1-FAB, with multilineage dysplasia. Blast cells were CD7⁺, CD13⁺, CD15⁺, CD33⁺, CD34⁺, HLA-DR⁺ and CD2⁻, CD3⁻, CD19⁻, CD41⁻, CD61⁻. The patient died of septic shock during drug-induced marrow aplasia.

Karyotyping was performed on unstimulated bone marrow cells after short-term culture. Chromosomes were G-banded and classified according to the International System for Human Cytogenetic Nomenclature.18 Fluorescence in situ hybridization (FISH) studies were performed as described elsewhere.19 We used a mixture of 2 BAC clones (118H17 and 290A12) labeled with biotin for theNUP98 gene.19 

The 8p11-12 breakpoint was investigated using YAC 176C9 (Dr M. Chaffanet, Marseilles, France) spanning the MOZ gene, BAC 350N15 spanning the FGFR1 gene, and BAC 513D5 telomeric to the FGFR1 locus. Probes were biotin-labeled. A centromeric probe labeled with digoxigenin was added in each experiment for chromosome 8 (D8Z1) or for chromosome 11 (D11Z1) (Oncor, Gaithersburg, MD). At least 8 metaphases were analyzed using an Olympus fluorescence microscope equipped with a cooled CCD camera (Sensys, Photometrics, Tucson, AZ) run by Pathvysion (Vysis, Stuttgart, Germany).

Database searches and sequence analyses were performed using BLAST algorithms (http://www.ncbi.nlm.nih.gov/BLAST) and RepeatMasker (http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker). AllNUP98 primers have been described previously19except NUP737F, AGTCACTAGAGGAACTTCG. NSD3 primers were designed on GenBank accession number AK022560 (FLJ536f, CAGAAATTCCAAACACAAGAC; FLJ940f, CCAGTTCAGCCAATACTATC; FLJ1856Af, AGCCAACGCAGAGTGTATCATC; FLJ2907Br, GGTGGGCCTCGTTAGACTGCTC; FLJ3081Cr, TTCCCCCAAAATTTCCATACAA; FLJ1204Df, GAAGAATTACTGGCTGAGGCAAC; FLJ1747Er, ATTTCCCATCCCCTGTAGCATTC) and GenBank accession number AF332469(W1L2863R1, AATTTGCGGACACAGGCTTC; W1L2685R2, TGCAGCACTCTCCCTCAC).

Total RNA was reverse-transcribed using SuperscriptII (Life Technologies, Gaithersburg, MD). Using the Expand Long Template PCR System (Roche, Mannheim, Germany) and the appropriate primers, cDNA aliquots were amplified in 10-μL polymerase chain reaction (PCR) as follows: 35 amplification cycles at 94°C for 5 minutes 10 seconds (94°C for 50 seconds, 58°C for 20 seconds, and 68°C for 4 minutes) and at 68°C for 5 minutes.

Nested PCR was carried out as follows: 35 amplification cycles at 94°C for 5 minutes (94°C for 30 seconds, 58°C for 20 seconds, 68°C for 2 minutes) and at 68°C for 5 minutes. Sequencing was performed with an automated ABI377 sequencing station after purification using Concert Rapid PCR Purification System (Life Technologies).

The t(8;11)(p11.2;p15) translocation was found as an isolated anomaly in all 20 bone marrow karyotypes from this patient with de novo AML. The mixture of BAC 118H17 and 290A12 was split, thus generating 3 spots of fluorescence: on normal chromosome 11, on der(11), and on der(8) (Figure 1A, left panel). BAC 350N15 spanned the 8p11-12 breakpoint, showing hybridization signals on normal chromosome 8, on der(8), and on der(11) (Figure 1A, right panel).

BAC 350N15 was found to contain 2 candidate genes, FGFR1 andNSD3, which were screened for an in-frame fusion transcript with NUP98. PCR experiments excluded FGFR1involvement. The NSD3 gene, like NSD2, is known to encode 2 splicing isoforms, a long form and a short form.20,21 Primers were first designed on the short form (FLJ1856Af, FLJ2907Br, FLJ3081Cr, FLJ1204Df, FLJ1747Er). As reports suggest, the 5′ end of NUP98 bears the oncogenic-related portion. PCR experiments investigated whether (5′)NUP98-NSD3(3′) chimeric transcripts were present in patient-derived cDNA.

Results showed NUP98-NSD3 fusion transcripts (Figure 1B, upper panel). The NUP1252F-FLJ1747Er amplification product was sequenced, confirming an in-frame fusion between the 2 genes (Figure1B, lower panel). Breakpoints were located between exons 3 and 4 in theNSD3 gene and between exons 11 and 12 in NUP98(Figure 2A-B). Successful amplification from primer FLJ3081Cr implied the expression of short-form chimericNSD3 (Figure 2C).

To investigate the expression of long-form mRNA (Figure 2D), nested PCR was performed with primers W1L2685R2 and W1L2863R1 in combination withNUP98 forward primers. Only one band, of the appropriate length, was amplified (data not shown), confirming that the long transcript was present. Because no product was extended after exon 12, the presence of exon 14, which is involved in alternative splicing20 (Figure 2A,E), could not be determined. We also analyzed the expression of the reciprocal transcript (5′)NSD3-NUP98(3′) by matching primers NUP1811R and NUP2887R with 2 NSD3 forward primers FLJ536f and FLJ940f. A specific band of the correct length (data not shown) revealed the patient's cells expressed reciprocal fusion mRNA. The reciprocal transcriptNSD3-NUP98 maintained the 5′ part of NSD3, encoding for a split PWWP domain, and the 3′ part of NUP98, with few FG repeats and the RNA-binding domain (Figure 2F).

As far as we know, NSD3 is the eighth NUP98partner in myeloid malignancies, so NUP98, likeMLL and ETV6, is emerging as a promiscuous gene that recombines and fuses with different genomic sites. In the NSD family, NSD1, located at 5q35, has been shown to rearrange with NUP98 in childhood AML.3,NSD2, located at 4p16, is the fusion partner of immunoglobulin heavy- chain gene at 14q32 in a recurrent translocation of multiple myeloma.21,22 Angrand et al20 foundNSD3 as part of an amplicon in breast cancer with 8p karyotypic abnormalities. We also confirmed NSD3amplification in 1 of 30 unselected cases of breast cancer analyzed by semiquantitative PCR (unpublished data, May 2001). This is the first report of NSD3 rearrangements in hematologic malignancies.

These 3 NSD family members have a common region of conserved architecture3,20,21—PHD fingers I-IV, PWWP, SAC/SET, PHD-V, and C5HCH (Figure 2A)—which suggests their involvement in chromatin remodeling and regulation of transcription. The fusion transcripts NUP98-NSD1 in t(5;11)3 andNUP98-NSD3 in t(8;11) both show this region fused to NUP98 FG repeats, which are known to bind transcription factors such as cyclic adenosine 3′,5′-monophosphate response element binding protein (CREB)-binding protein.23 Moreover, transcriptional regulation genes, such as PMX1,1,HOXD13,2,HOXA9,4,5 andLEDGF,6 are other fusion partners forNUP98 in malignancies. Altogether, these data support the hypothesis that the transcription regulation function is critical forNUP98 fusion gene oncogenicity.

In conclusion, NSD3 has been observed for the first time as a translocation partner of NUP98 in acute myeloid leukemia. Further functional analysis of the chimeric transcripts will elucidate their specific role in leukemogenesis.