CD1a Is a Dimorphic Antigen-Presenting Protein That May Be Mismatched without Increasing the Risk of Graft Versus Host Disease.

On behalf of Eurobank Members

CD1a is a lipid antigen-presenting protein related to MHC class I that is frequently but incorrectly said to be non-polymorphic. There are two alleles in humans that differ by two linked amino acid substitutions, I13T and W51C in the alpha-1 domain. Substitution of threonine and cysteine in the minor allele may modify the structure of the antigen-binding groove and influence antigen specificity and T cell recognition. The CD1a gene on chromosome 1 may be mismatched in MHC identical sibling transplants, but the effect of this on GVHD is unknown. We hypothesized that CD1a might act as a tissue antigen and that GVHD would increase in recipients who possessed an allele unknown to the donor.

163 recipient-donor sibling pairs transplanted with full and reduced intensity conditioning but without T depletion were identified from a database of all sequential transplants performed in Newcastle from Nov 1984 to Sept 2004 and in collaborating Eurobank centres from Nov 1997 to Sept 2004. DNA was amplified by PCR primers 5′: CCTGGAAACAAAATCTGGTC and 3′: GGGTACTTAACGTCAAACTT producing a 209 bp fragment, encompassing the C to G substitution at nucleotide 738 (W51C). This was analysed by SSCP and RFLP using the Hae III site 737–741.

The overall allele frequency was: allele 1 (I13; W51): 0.07; allele 2 (T13; C51): 0.93. 148 pairs were matched at CD1a (2,2 into 2,2 or 1,2 into 1,2) and 15 were unmatched in the GVHD direction (2,2 into 1,2). There were no significant differences between the cohorts in age, gender mismatch, conditioning or transplant center. 5 year projected survival was 57% months in the matched cohort and 59% months in the unmatched (p=0.10 Kaplan-Meier). 43/148 (29%) matched transplants received cyclosporin alone GVHD prophylaxis compared with 9/15 (60%) of unmatched transplants (p=0.01; Fisher’s exact test). The incidence and severity of GVHD was similar in both matched and unmatched cohorts: grade I–IV: 81% and 87% respectively (p=0.59); II–IV: 61% and 62% (p=0.48); III–IV: 22% and 20% (p=0.51; Fisher’s exact test). The use of less GVHD prophylaxis in the unmatched group strengthens a negative result and as predicted, no increase in risk due to mismatching was revealed after correction for GVHD prophylaxis and other variables by binomial logistic regression.

CD1a is an antigen-presenting molecule important in host defense. It is dimorphic in humans with a minor allele found in 16% of individuals and mismatched in the GVHD direction in 9% of HLA-identical sibling allogeneic transplants. Although amino acid substitution may alter the antigen specificity of the two isoforms of CD1a, mismatching does not increase the risk of GVHD and therefore CD1a does not appear to function as a tissue antigen in transplantation. This functional result supports recent structural analysis of the CD1a-TCR interaction showing that the glycolipid antigen makes little contribution to TCR binding, in contrast to the peptide antigens of conventional class I MHC molecules, which play an essential role in T cell recognition (