Molecular genetic analysis for the B³allele

In addition to the common ABO phenotypes, A₁, A₂, B, and O, numerous phenotypes with a weak expression of the A or B antigens on the red blood cells (RBCs) have been found.1-6 The B₃ phenotype is characterized by mixed-field hemagglutination of RBCs with anti-B and anti-A–anti-B antibodies. Only limited results have been reported on the molecular genetic analysis of 4 B₃ cases so far.7,8 The B₃ phenotype was found to be the most common subgroup in Taiwanese.9-12 This study presents the molecular genetic analysis of 14 samples from unrelated Taiwanese individuals with the B₃phenotype.

Preparation of the genomic DNAs and the analysis of the 7 exon regions of the ABO genes were as described previously.13 

A polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) analysis was developed to demonstrate the intervening sequence–3 [IVS3] + 5G → A mutation in theB gene, as the G → A change creates a BsmI site (GAATGC). We combined 100 ng genomic DNA and 15 pmol each forward (CGTACCTGCCTCGAGGCCTTGCAGCTTCAC) and reverse (CAGCACCCCGGCCAGCATGGATGCTCCAC) primer in 25 μL PCR buffer containing 0.2 mM deoxynucleoside 5′-triphosphate and 0.5 U Taqpolymerase. The PCR program included 5 minutes at 94°C followed by 30 cycles of 30 seconds at 94°C and 1 minute at 72°C. The PCR products were digested by BsmI enzyme and then analyzed by 3.5% agarose gel electrophoresis.

Total RNAs were prepared from peripheral blood cells. The complementary DNAs (cDNAs) were primed by oligodeoxythymidine primer, and 2 rounds of PCR amplification followed. The first PCR was performed with forward (TTGCGGACGCTGGCCGGAAAACCAAA, spanning the exon 1-2 junction of ABO cDNA) and reverse (TGTCCACGTCCACGCACACCAGGTAATCCA, locating exon 7) primers. Products from the first PCR were amplified by nested forward (CAAAATGCCACGCACTTCGACCTATGATCC, locating exon 2) and reverse (CGCTCGCAGAAGTCACTGATC, locating exon 7) primers. The PCR conditions were similar to those described above, except that the annealing temperatures were 65°C and 60°C in the first and the nested PCR, respectively.

The sequences of the 7 exons and the adjacent splice sites of the ABO gene of the individual with the B₃phenotype were inspected. The results demonstrated that the individual harbored a B gene and an O^1v gene with the respective wild-type coding sequences.4,14However, a G → A substitution at the +5 nucleotide of intron 3 (IVS3 + 5G → A) was identified in the B gene. No abnormality was detected in 7 of the 12 clones bearing the fragment encompassing the exon 2–intron 3 region. These 7 clones represented O^1v gene as they had a T nucleotide at position 106 of ABO cDNA.4 14 The other 5 clones representing B gene possessed the IVS3 + 5G → A mutation. Direct sequencing of the PCR product demonstrated the heterozygous state of the G and A nucleotides at that position (Figure1, right panel). Direct sequencing of the PCR product amplified from a group B individual did not show the G → A change at that position (Figure 1, left panel).

The PCR-RFLP analysis was used to detect the IVS3 + 5 G → A mutation in the other 13 unrelated B₃ individuals and in 30 randomly selected group B individuals. Twelve of the other 13 B₃ individuals (Figure 2, lanes 2-13) had one allele with the IVS3 + 5G → A mutation at their ABO loci, as did the B₃ propositus (lane 1), while none of the 30 group B individuals possessed the mutation (one of the results is shown in Figure 2, lane B). Further analysis demonstrated that all of the 12 B₃ individuals with the IVS3 + 5G → A mutation were heterozygotes with one Oallele as in the B₃ propositus (data not shown). These results show that 13 of the 14 B₃ individuals possess theB gene with the IVS3 + 5G → A mutation, while the mutation is virtually absent in the general group B population. One B₃ individual did not possess the mutation in theB gene (Figure 2, lane 14).

The ABO gene of the B₃ individual without the IVS3 + 5G → A mutation was analyzed as described above. This B₃ individual was shown to have aB/O1  genotype, and a nucleotide change of 247G → T (translation initiation codon of ABOcDNA as nucleotides 1 to 3) was identified in the B gene. The 247 position locates in the exon 6 region, and the G → T mutation predicts an Asp83Tyr amino acid alteration. The nucleotide 247 position of the ABO genes of 30 group B individuals was inspected through PCR amplification and sequencing; none of them possessed a G → T mutation.

As the IVS3 + 5G → A mutation changes the consensus sequence of a splice donor site (GT^A/_GAGT),15-18 the transcript structures encoded from the B allele with the splice site mutation were inspected by reverse transcription PCR (RT-PCR). Two fragments (559 and 424 bp) were obtained from the RNA sample from the group B individual (Figure 3A, lane B). Direct sequencing of the products revealed that the larger fragment was composed of the complete B exon 2–exon 7 cDNA structure, while the smaller one had the same structure but without the exon 6 region. RT-PCR of the RNA of the B₃ individual gave 2 smaller products (502 and 367 bp) (Figure 3A, lane B₃). The 502-bp fragment was demonstrated to be the B exon 2–exon 7 structure with exon 3 skipped (Figure 3B), and the 367-bp fragment was the same structure without the exon 3 and exon 6 regions.

Although the B₃ individual possesses a normalO^1v allele, the O^1vtranscript was not detected in this RT-PCR analysis. This phenomenon is believed to result from a decreased stability of the Oallele transcript.19 The presence of the transcripts without exon 6 is believed to result from alternative splicing of theABO transcripts.4 20 The transcript with exon 6 skipped develops a translation stop codon at the exon 5–exon 7 junction, and thus is believed to be unable to produce a product with transferase activity.

The complete exon 1–exon 7 transcript of the B gene was shown to be virtually absent in the RNA of the B₃individual with the IVS3 + 5G → A mutation, and instead, both of the transcripts encoded from the B3  allele with the splice site mutation skipped exon 3. These results show that the IVS3 + 5G → A mutation in the B gene destroys the consensus of the splice donor site and thus leads to the skipping of exon 3 during mRNA splicing processes (Figure 4).

Exon 3 of the ABO gene comprises 57 bp, and theB3  transcript without exon 3 still retains the reading frame and predicts a protein product that lacks 19 amino acid residues in the N-terminal portion (Figure5). The deleted segment of the 19 amino acids includes several residues of the predicted transmembrane domain of a normal B transferase. Whether this affects or changes the enzyme characteristic of the transferase is worth further investigation.

The authors would like to thank the Taipei Blood Donation Center for help in collecting B₃ blood samples.