Molecular genetic analysis of 14 samples from unrelated individuals with the B3 phenotype is reported here. Two different molecular changes in the blood group B gene were observed. One case was demonstrated to possess a 247G → T mutation, which predicts an Asp83Tyr alteration. The B genes of the other 13 cases were shown to have a G → A mutation at the +5 nucleotide of intron 3 (intervening sequence 3 [IVS3] + 5G → A). Reverse transcription polymerase chain reaction analysis showed that the complete exon 1–exon 7 B transcript was absent, and transcripts that skipped exon 3 were instead present in the RNA sample from the B3 individual with the IVS3 + 5G → A mutation. The result shows that the IVS3 + 5G → A mutation destroys the conserved sequence of the splice donor site and leads to the skipping of exon 3 during messenger RNA processing. TheB3 transcript without exon 3 predicts a B-transferase product that lacks 19 amino acids in the N-terminal segment.
Introduction
In addition to the common ABO phenotypes, A1, A2, B, and O, numerous phenotypes with a weak expression of the A or B antigens on the red blood cells (RBCs) have been found.1-6 The B3 phenotype is characterized by mixed-field hemagglutination of RBCs with anti-B and anti-A–anti-B antibodies. Only limited results have been reported on the molecular genetic analysis of 4 B3 cases so far.7,8 The B3 phenotype was found to be the most common subgroup in Taiwanese.9-12 This study presents the molecular genetic analysis of 14 samples from unrelated Taiwanese individuals with the B3phenotype.
Study design
Sequence analysis of the ABO gene and polymerase chain reaction–restriction fragment length polymorphism analysis
Preparation of the genomic DNAs and the analysis of the 7 exon regions of the ABO genes were as described previously.13
A polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) analysis was developed to demonstrate the intervening sequence–3 [IVS3] + 5G → A mutation in theB gene, as the G → A change creates a BsmI site (GAATGC). We combined 100 ng genomic DNA and 15 pmol each forward (CGTACCTGCCTCGAGGCCTTGCAGCTTCAC) and reverse (CAGCACCCCGGCCAGCATGGATGCTCCAC) primer in 25 μL PCR buffer containing 0.2 mM deoxynucleoside 5′-triphosphate and 0.5 U Taqpolymerase. The PCR program included 5 minutes at 94°C followed by 30 cycles of 30 seconds at 94°C and 1 minute at 72°C. The PCR products were digested by BsmI enzyme and then analyzed by 3.5% agarose gel electrophoresis.
Analysis of the ABO transcript structure
Total RNAs were prepared from peripheral blood cells. The complementary DNAs (cDNAs) were primed by oligodeoxythymidine primer, and 2 rounds of PCR amplification followed. The first PCR was performed with forward (TTGCGGACGCTGGCCGGAAAACCAAA, spanning the exon 1-2 junction of ABO cDNA) and reverse (TGTCCACGTCCACGCACACCAGGTAATCCA, locating exon 7) primers. Products from the first PCR were amplified by nested forward (CAAAATGCCACGCACTTCGACCTATGATCC, locating exon 2) and reverse (CGCTCGCAGAAGTCACTGATC, locating exon 7) primers. The PCR conditions were similar to those described above, except that the annealing temperatures were 65°C and 60°C in the first and the nested PCR, respectively.
Results and discussion
Identification of the IVS3 + 5G → A mutation in theB gene of the B3propositus
The sequences of the 7 exons and the adjacent splice sites of the ABO gene of the individual with the B3phenotype were inspected. The results demonstrated that the individual harbored a B gene and an O1v gene with the respective wild-type coding sequences.4,14However, a G → A substitution at the +5 nucleotide of intron 3 (IVS3 + 5G → A) was identified in the B gene. No abnormality was detected in 7 of the 12 clones bearing the fragment encompassing the exon 2–intron 3 region. These 7 clones represented O1v gene as they had a T nucleotide at position 106 of ABO cDNA.4 14 The other 5 clones representing B gene possessed the IVS3 + 5G → A mutation. Direct sequencing of the PCR product demonstrated the heterozygous state of the G and A nucleotides at that position (Figure1, right panel). Direct sequencing of the PCR product amplified from a group B individual did not show the G → A change at that position (Figure 1, left panel).
Sequencing results of the exon 3–intron 3 junction of the ABO genes of a common group B individual and the B3 propositus.
Genomic DNAs were purified from an individual with common group B phenotype and an individual with B3 phenotype. The regions from exon 2 to intron 3 of the ABO genes were amplified by PCR, and the sequences were analyzed by direct sequencing. The sequencing results of the exon 3–intron 3 junctions of the common group B (left panel) and the B3 (right panel) samples are shown. In the B3 sample, a heterozygous state for G and A nucleotides (underlined) at the +5 position of intron 3 was demonstrated. A dashed line indicates the conserved sequence of the splice donor site.
Sequencing results of the exon 3–intron 3 junction of the ABO genes of a common group B individual and the B3 propositus.
Genomic DNAs were purified from an individual with common group B phenotype and an individual with B3 phenotype. The regions from exon 2 to intron 3 of the ABO genes were amplified by PCR, and the sequences were analyzed by direct sequencing. The sequencing results of the exon 3–intron 3 junctions of the common group B (left panel) and the B3 (right panel) samples are shown. In the B3 sample, a heterozygous state for G and A nucleotides (underlined) at the +5 position of intron 3 was demonstrated. A dashed line indicates the conserved sequence of the splice donor site.
The IVS3 + 5G → A mutation is present in 13 out of 14 B3 individuals
The PCR-RFLP analysis was used to detect the IVS3 + 5 G → A mutation in the other 13 unrelated B3 individuals and in 30 randomly selected group B individuals. Twelve of the other 13 B3 individuals (Figure 2, lanes 2-13) had one allele with the IVS3 + 5G → A mutation at their ABO loci, as did the B3 propositus (lane 1), while none of the 30 group B individuals possessed the mutation (one of the results is shown in Figure 2, lane B). Further analysis demonstrated that all of the 12 B3 individuals with the IVS3 + 5G → A mutation were heterozygotes with one Oallele as in the B3 propositus (data not shown). These results show that 13 of the 14 B3 individuals possess theB gene with the IVS3 + 5G → A mutation, while the mutation is virtually absent in the general group B population. One B3 individual did not possess the mutation in theB gene (Figure 2, lane 14).
PCR-RFLP analysis of the IVS3 + 5 G → A splice site mutation in ABO genes.
The IVS3 + 5G → A mutation identified in the B gene of the B3 propositus creates a BsmI site. The 247-bp PCR product, encompassing the exon 3–intron 3 junction, amplified from the gene with the IVS3 + 5G → A mutation yielded 206- and 41-bp fragments, after digestion with BsmI restriction endonuclease, while the 247-bp PCR product from a wild-type gene was resistant to digestion. The BsmI-cleaved products were analyzed by 3.5% agarose gel electrophoresis. Samples from the B3 propositus (lane 1) and another 13 unrelated B3 individuals (lanes 2-14) together with samples from 30 randomly selected group B individuals were subjected to PCR-RFLP analysis. One of the results obtained from the group B individuals is shown in lane B. Lane M shows the molecular mass standards of the 100-bp ladder. The results indicate that 13 of the 14 B3individuals, all but the 1 shown in lane 14, possessed one allele with the IVS3 + 5G → A mutation, while none of the 30 group B individuals had the mutation.
PCR-RFLP analysis of the IVS3 + 5 G → A splice site mutation in ABO genes.
The IVS3 + 5G → A mutation identified in the B gene of the B3 propositus creates a BsmI site. The 247-bp PCR product, encompassing the exon 3–intron 3 junction, amplified from the gene with the IVS3 + 5G → A mutation yielded 206- and 41-bp fragments, after digestion with BsmI restriction endonuclease, while the 247-bp PCR product from a wild-type gene was resistant to digestion. The BsmI-cleaved products were analyzed by 3.5% agarose gel electrophoresis. Samples from the B3 propositus (lane 1) and another 13 unrelated B3 individuals (lanes 2-14) together with samples from 30 randomly selected group B individuals were subjected to PCR-RFLP analysis. One of the results obtained from the group B individuals is shown in lane B. Lane M shows the molecular mass standards of the 100-bp ladder. The results indicate that 13 of the 14 B3individuals, all but the 1 shown in lane 14, possessed one allele with the IVS3 + 5G → A mutation, while none of the 30 group B individuals had the mutation.
One B3 individual possesses the B gene with 247G → T missense mutation
The ABO gene of the B3 individual without the IVS3 + 5G → A mutation was analyzed as described above. This B3 individual was shown to have aB/O1 genotype, and a nucleotide change of 247G → T (translation initiation codon of ABOcDNA as nucleotides 1 to 3) was identified in the B gene. The 247 position locates in the exon 6 region, and the G → T mutation predicts an Asp83Tyr amino acid alteration. The nucleotide 247 position of the ABO genes of 30 group B individuals was inspected through PCR amplification and sequencing; none of them possessed a G → T mutation.
Exon 3 is skipped in the transcripts encoded from the Ballele with the IVS3 + 5G → A mutation
As the IVS3 + 5G → A mutation changes the consensus sequence of a splice donor site (GTA/GAGT),15-18 the transcript structures encoded from the B allele with the splice site mutation were inspected by reverse transcription PCR (RT-PCR). Two fragments (559 and 424 bp) were obtained from the RNA sample from the group B individual (Figure 3A, lane B). Direct sequencing of the products revealed that the larger fragment was composed of the complete B exon 2–exon 7 cDNA structure, while the smaller one had the same structure but without the exon 6 region. RT-PCR of the RNA of the B3 individual gave 2 smaller products (502 and 367 bp) (Figure 3A, lane B3). The 502-bp fragment was demonstrated to be the B exon 2–exon 7 structure with exon 3 skipped (Figure 3B), and the 367-bp fragment was the same structure without the exon 3 and exon 6 regions.
ABO transcript structures of the group B individual and the B3 individual with the IVS3 + 5G → A mutation analyzed by RT-PCR.
(A) RT-PCR results obtained from the RNA samples of the group B individual and the B3 individual with the IVS3 + 5G → A mutation. The RT-PCR products were analyzed by 3.0% agarose gel electrophoresis. The results obtained from the common B and the B3 samples are shown in lane B and lane B3, respectively. Lane M shows the molecular mass standards of the 100-bp ladder. The 2 products (559 and 424 bp) from the group B sample were demonstrated to be amplified from the complete BcDNA structure and from the B cDNA structure without the exon 6 region, respectively. The 2 smaller products (502 and 367 bp) from the B3 sample were shown to be amplified, respectively, from the B cDNA with exon 3 skipped and from the B cDNA with exon 3 and exon 6 skipped. (B) Sequencing result of the 502-bp product obtained from the B3 RNA sample. The 502-bp fragment obtained from the B3 RNA sample was eluted from the agarose gel and sequenced. It was demonstrated to have the exon 2–exon 7 structure but without the exon 3 region. The linkage of exon 2 and exon 4, indicating the skipping of exon 3, is shown.
ABO transcript structures of the group B individual and the B3 individual with the IVS3 + 5G → A mutation analyzed by RT-PCR.
(A) RT-PCR results obtained from the RNA samples of the group B individual and the B3 individual with the IVS3 + 5G → A mutation. The RT-PCR products were analyzed by 3.0% agarose gel electrophoresis. The results obtained from the common B and the B3 samples are shown in lane B and lane B3, respectively. Lane M shows the molecular mass standards of the 100-bp ladder. The 2 products (559 and 424 bp) from the group B sample were demonstrated to be amplified from the complete BcDNA structure and from the B cDNA structure without the exon 6 region, respectively. The 2 smaller products (502 and 367 bp) from the B3 sample were shown to be amplified, respectively, from the B cDNA with exon 3 skipped and from the B cDNA with exon 3 and exon 6 skipped. (B) Sequencing result of the 502-bp product obtained from the B3 RNA sample. The 502-bp fragment obtained from the B3 RNA sample was eluted from the agarose gel and sequenced. It was demonstrated to have the exon 2–exon 7 structure but without the exon 3 region. The linkage of exon 2 and exon 4, indicating the skipping of exon 3, is shown.
Although the B3 individual possesses a normalO1v allele, the O1vtranscript was not detected in this RT-PCR analysis. This phenomenon is believed to result from a decreased stability of the Oallele transcript.19 The presence of the transcripts without exon 6 is believed to result from alternative splicing of theABO transcripts.4 20 The transcript with exon 6 skipped develops a translation stop codon at the exon 5–exon 7 junction, and thus is believed to be unable to produce a product with transferase activity.
The complete exon 1–exon 7 transcript of the B gene was shown to be virtually absent in the RNA of the B3individual with the IVS3 + 5G → A mutation, and instead, both of the transcripts encoded from the B3 allele with the splice site mutation skipped exon 3. These results show that the IVS3 + 5G → A mutation in the B gene destroys the consensus of the splice donor site and thus leads to the skipping of exon 3 during mRNA splicing processes (Figure 4).
Diagrammatic representation of the molecular basis for the B3 allele with the IVS3 + 5G → A splice site mutation.
The IVS3 + 5G → A mutation of the B3 allele changes the consensus sequence of the splice donor site and causes the removal of exon 3 during the mRNA splicing processes, making the exon a pseudoexon. The dashed lines represent the intron regions, and the solid lines illustrate the linkages of exons during mRNA processing.
Diagrammatic representation of the molecular basis for the B3 allele with the IVS3 + 5G → A splice site mutation.
The IVS3 + 5G → A mutation of the B3 allele changes the consensus sequence of the splice donor site and causes the removal of exon 3 during the mRNA splicing processes, making the exon a pseudoexon. The dashed lines represent the intron regions, and the solid lines illustrate the linkages of exons during mRNA processing.
Exon 3 of the ABO gene comprises 57 bp, and theB3 transcript without exon 3 still retains the reading frame and predicts a protein product that lacks 19 amino acid residues in the N-terminal portion (Figure5). The deleted segment of the 19 amino acids includes several residues of the predicted transmembrane domain of a normal B transferase. Whether this affects or changes the enzyme characteristic of the transferase is worth further investigation.
Comparison of the amino acid sequences predicted from the B transcript and theB3 transcript with exon 3 skipped.
A normal B cDNA predicts a polypeptide of 354 amino acids with a transmembrane segment of residues 17 through 37 (double underlined). The amino acid sequence predicted from theB3 transcript with exon 3 skipped lacks 19 amino acid residues in the N-terminal portion and preserves the majority of the transferase protein with the catalytic C-terminal remaining intact. The translation start and stop codons are underlined.
Comparison of the amino acid sequences predicted from the B transcript and theB3 transcript with exon 3 skipped.
A normal B cDNA predicts a polypeptide of 354 amino acids with a transmembrane segment of residues 17 through 37 (double underlined). The amino acid sequence predicted from theB3 transcript with exon 3 skipped lacks 19 amino acid residues in the N-terminal portion and preserves the majority of the transferase protein with the catalytic C-terminal remaining intact. The translation start and stop codons are underlined.
The authors would like to thank the Taipei Blood Donation Center for help in collecting B3 blood samples.
Prepublished online as Blood First Edition Paper, April 30, 2002; DOI 10.1182/blood-2002-01-0188.
Supported in part by National Health Research Institute grant NHRI-EX90-8601SL (M.L.) and National Science Council grant NSC 90-2320-B-195-004 (L.-C.Y.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 U.S.C. section 1734.
