In the supplemental data for the article beginning on page 133 of the January 7, 2010 issue, the mouse tie-1AS long noncoding RNA (lncRNA) sequence reported is a nonspecific primed product from the RACE reaction. In recent follow-up work, the authors retrieved the correct sequence of mouse tie-1AS lncRNA, which is a confirmed 5′ RACE product. This sequence only contains the partial mouse tie-1AS lncRNA on the 5′ end, whereas the sequence on the 3′ end is missing.

The reported incorrect sequence in the article was not used in any assays reported in the article. Therefore, the conclusions are not affected. The authors also checked the zebrafish and human sequences in the supplemental materials again, and they are part of the respective tie-1 genomic loci. The new sequence and location are shown below.

GTATAAGCAGAGAGTCGGGGGCTAAACAGGGTGTTAGTAACATGCATGCTGCTTTAGGTGGAGGATCAGAAGTGGGGTTTGGGTTTGGGGAGCCGCAGAGAGGAAGGGTAGCTATGGGAACAGCTGGCAAGAAAGGGGATGCCTGTTTCCCTCCCCCCTCCCCCCCTTTTCCTGGATCTTTTCTTTCCTCCTTTAAATTAAAGACTTTCTTGAGACAGCTTGGGTCAGAGGTGAGAAGGG

Sign in via your Institution