C/EBPɛ Directly Interacts With the DNA Binding Domain of c-myb and Cooperatively Activates Transcription of Myeloid Promoters

The construction of the C/EBPε (p30) expression vector and the amino-terminal truncation mutants were described previously.2,18 Eukaryotic expression vectors for the C/EBPε isoforms p32, p27, p14, and murine C/EBPα were a generous gift from Dr K. Xanthopoulos (Aurora Inc, San Diego, CA). The pCMV4 c-myb expression vector was kindly provided by Linda Shapiro (St Jude’s Hospital, Memphis, TN), and the HA epitope-tagged CBP expression vector was from R. Goodman (Vollum Institute, Oregon Health Sciences, University of Oregon, Portland, OR).40 Neutrophil elastase promoter-luciferase constructs were described previously.23The Mim-1 promoter (−240 to +150) luciferase construct was a kind gift from Dr A. Leutz (Max Delbrueck Center for Molecular Medicine, Berlin, Germany).30 

For preparation of nuclear extracts, 5 × 10⁶ COS-1 cells were washed three times with ice-cold phosphate-buffered saline (PBS). After the last wash, adherent cells were scraped off the dish with a rubber policeman and resuspended in 500 μL extraction buffer B (20 mmol/L HEPES, pH 7.9, 20% glycerol, 10 mmol/L NaCl, 0.2 mmol/L EDTA, 1.5 mmol/L MgCl₂, 0.1% Triton X, 1 mmol/L dithiothreitol [DTT], 1 mmol/L phenylmethyl sulfonyl fluoride [PMSF], 40 μL/mL Complete [Boehringer, Indianapolis, IN]). After 15 minutes of incubation on ice, the nuclei were pelleted at 250g for 10 minutes. Nuclei were resuspended in extraction buffer B, and NaCl was added dropwise with mixing to a final concentration of 300 mmol/L NaCl. Nuclei were rocked for 60 minutes at 4°C. Samples were microcentrifuged at 12,000 RPM and supernatants were frozen at −80°C.

A total of 10⁷ Kcl22, U937, KG-1, and NB4 cells were washed twice in ice-cold PBS and subsequently lysed in RIPA buffer supplemented with protease inhibitors. NB4 cells (5 × 10⁵) were grown in RPMI + 10% fetal bovine serum (FBS) + 10⁻⁶ mol/L all-trans-retinoic acid for 24 hours before protein extracts were prepared in RIPA buffer.

Nuclear extracts (15 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gel. The gel was electroblotted on a polyvinylidene difluoride membrane (Immobilon-P; Millipore, Bedford, MA). The membrane was blocked with 1% gelatin and incubated with the primary antibody (rabbit polyclonal antibody, dilution 1:1,000 to 1:2,000) and a secondary horseradish peroxidase-conjugated donkey antirabbit antibody (Amersham, Arlington Heights, IL). Detection was performed using the ECL detection kit (Amersham).

The generation of affinity-purified rabbit polyclonal C/EBPε antibody against amino acids 1-115 of C/EBPε p30 was described previously by us.2 Rabbit polyclonal antibodies to C/EBPα, C/EBPβ, C/EBPδ, and murine and human c-myb, epitope (aa 98-108) of influenza hemagglutinin protein as well as CBP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

C/EBPε and C/EBPα genes cloned downstream of the T7 promoter in pCDNA I/III (Invitrogen, Carlsbad, CA) were transcribed with T7 RNA polymerase and in vitro translated in rabbit reticulocyte lysate using the TNT coupled Reticulocyte lysate system (Promega, Madison, WI) with³⁵S methionine (>1,000 Ci/mmol; Amersham) as a label in the translation reaction. The procedure was performed according to the manufacturer.

A fusion of the gene coding for maltose binding protein (MBP) and C/EBPε was constructed using the pMalc2 plasmid (New England Biolabs, Beverly, MA) as a backbone. C/EBPε cDNA (p30) was cloned in-frame downstream of the MBP sequence. MBP, MBP-C/EBPε, GST-C/EBPε 1-115 (amino-acids 1-115 of C/EBPε p30), and GST were expressed in the bacterial host BL21. GST-c-myb and truncation mutants were kindly provided by Dr Timothy Bender and expressed as previously described.41 42 Soluble protein was prepared by sonication of the bacterial culture 4 hours after induction with 100 mmol/L isoprophyl β-D thiogalactopyranoside (IPTG). Amylose resin (New England Biolabs) or glutathione sepharose beads (Pharmacia Biotech, Uppsala, Sweden) were loaded with equal amounts of the different fusion proteins. The loaded amylose resin and the glutathione sepharose beads were washed three times with column buffer (20 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl, 0.5 mmol/L EDTA, 0.1mmol/L DTT) and then incubated 2 hours either with COS-1 cell nuclear extract expressing either the c-myb or C/EBPε protein or with in vitro translated ³⁵S-methionine labeled C/EBPε protein. The resin (MBP fusion) or the beads (GST fusions) were washed three times with pulldown assay buffer (150 mmol/L NaCl, 20 mmol/L Tris-Cl, pH 7.5, 0.3% NP40, 0.1 mmol/L EDTA, 1 mmol/L DTT, 1 mmol/L PMSF, 10 μg/mL leupeptin and pepstatin) and resuspended in 25 μL 1× SDS-PAGE sample buffer. The samples were boiled for 5 minutes and separated by electrophoresis on a 4% to 15% gradient SDS polyacrylamide minigel (Bio-Rad, Hercules, CA). The gel was electroblotted overnight and probed with antibody against either c-myb or C/EBPε. When using ³⁵S-methionine–labeled proteins, the gel was directly fixed in 40% methanol/10% acetic acid; dehydrated in 10% methanol, 2.5% acetic acid, and 2.5% glycerol; dried; and exposed overnight to Kodak Biomax X-ray film (Eastman Kodak, Rochester, NY).

Double-stranded oligonucleotides (30 bp) containing the C/EBP consensus site of a specific promoter and adjacent sequences were end-labeled with ³²P γATP. A standard reaction contained 1 ng labeled probe, 10 μg COS-1 nuclear extract expressing either C/EBPε or C/EBPα, 2 μg pdIdC, and 4.5 μg bovine serum albumin (BSA) in a 20 μL volume. Competing cold oligonucleotides (shown below at 10- and 100-fold molar excess) or antibodies (1 μg/μL) were added where indicated. Electrophoresis was performed on a 4% polyacrylamide gel at 30 mA. Neutrophil elastase: 5′ TCGAGGCCAGGATGGGGCAATACAACCC 3′; mutant neutrophil elastase: 5′ TCGAGGCCAGGACTCGAGGATACAACCCG 3′; G-CSF receptor: 5′ AAGGTGTTGCAATCCCAGC 3′.

For protein expression, 10 μg of eukaryotic expression vector (C/EBPε, C/EBPα, c-myb, and CBP-HA) was transfected into COS-1 cells (10-cm dish). Transfection was performed with Superfect reagent (Qiagen, Valencia, CA) over 3 hours according to the manufacturer’s protocol. Nuclear extracts were prepared after 48 hours, as described above.

For reporter gene assays, CV-1 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) + 10% fetal calf serum (FCS). Approximately 5 × 10⁵ cells/dish were plated in 60-mm dishes at 1 day before transfection. Promoter-reporter constucts (5 μg) and expression vectors (100 ng to 1 μg) as well as a control 1 μg pCMV-Gal vector (1 μg) were ethanol precipitated and resuspended in 25 μL sterile TE buffer. Transfection was performed with Superfect reagent (Qiagen) as described above. Cells were washed with PBS and fed with DMEM + 10% FCS. Protein extracts were prepared 40 hours later in reporter lysis buffer (Promega). Luciferase activity was determined according to standard procedures. β-Galactosidase activity was used to normalize transfection efficiencies.

Approximately 2.5 × 10⁷ Kcl22 or U937 myeloid cells were transfected by electroporation at 340 V with 15 μg of reporter plasmid, 5 μg of expression plasmid, and 3 μg of β-galactosidase vector in 500 μL RPMI + 10% FCS. Cells were harvested after 16 hours.

Transfection of 2 to 3 × 10⁶ Jurkat cells was performed with 20 μL Lipofectin reagent (GIBCO BRL, Gaithersburg, MD) according to the manufacturer’s protocol using 3 μg reporter plasmid, 330 ng expression plasmid (or 75 to 750 ng in dose-response experiments), and 1 μg pCMV-βGal vector and adjusted to 5 μg total DNA with empty expression vector. At 24 hours posttransfection, cells were activated with TPA (5 ng/mL) and calcium ionophore A21387 (125 ng/mL). At 48 hours posttransfection, cells were lysed with reporter lysis buffer (Promega) and micocentrifuged at 12,000 RPM. Supernatants were assayed for luciferase activity. To monitor the levels of the exogenously expressed C/EBPε proteins, a pellet from each sample was resuspended in RIPA buffer (50 mmol/L Tris-Cl, pH 8.0, 1% NP40, 0.5% deoxycholicacidsodiumsalt (DOC), 0.1% SDS, 300 mmol/L NaCl, Complete 40 μL/mL), rocked for 1 hour at 4°C, and microcentrifuged at 12,000 RPM. C/EBPε was immunoprecipitated with 0.5 μg affinity-purified C/EBPε antibody and collected with Protein A sepharose beads. The beads were washed three times in IP buffer (50 mmol/L Tris-Cl, pH 7.4, 150 mmol/L NaCl, 0.5% NP40) and then resuspended in SDS-PAGE sample buffer. Samples were electrophoresed on a 10% to 20% gradient polyacrylamide gel containing SDS, electroblotted, and probed with C/EBPε antibody.

Two translation start sites were previously described for C/EBPε.1,2 The first generates a protein with a predicted molecular weight of 32.2 kD (p32 isoform); the second in-frame ATG generates a protein that is 32 amino acids shorter (p30 isoform). We examined myeloid leukemia cell lines for the expression of these two isoforms by Western blot analysis and found that both isoforms were present in the myeloid cell lines Kcl22, NB4, and U937 at a ratio of approximately 2:1 (p32:p30). Cell line KG-1 did not express C/EBPε (Fig 1). We previously reported the upregulation of C/EBPε during granulocytic differentiation of cell line NB-4 with retinoid treatment.43 Interestingly, we find that only the p30 isoform of C/EBPε was upregulated 24 hours after treatment of NB4 cells with 10⁻⁶ mol/L all-trans retinoic acid. The level of isoform p32 remained unchanged, indicating that both isoforms are differentially regulated (lane 7). For comparison, C/EBPε p32 (lane 1) and p30 (lane 2) proteins expressed in transfected COS-1 cells were run alongside the nuclear extracts from myeloid cell lines.

Because the DNA binding domains of C/EBP proteins are highly homologous, we hypothesized that the DNA binding site of C/EBPε is either similar or identical to the known sites of other C/EBP proteins. Double-stranded oligonucleotides representing C/EBP sites of the neutrophil elastase and G-CSF receptor promoter were used for EMSA. C/EBPε (p32/p30) expressed in COS-1 cells was able to bind to both sites and binding was competed by cold self oligonucleotide and supershifted by antibody to C/EBPε. A similar binding was seen with C/EBPα expressed in COS-1 cells (Fig 2A). Also, C/EBPε present in nuclear extracts of the myeloid cell line Kcl22 bound to the C/EBP site of the neutrophil elastase promoter (Fig2B). The complex was supershifted by the affinity-purified C/EBPε antiserum and its formation was inhibited by the commercially available antibody against CRP1 (rat homolog of C/EBPε), demonstrating that the complex contained C/EBPε (Fig 2B, lanes 7 and 8). The complex could not be supershifted by antibodies against C/EBPα, C/EBPβ, and C/EBPδ (Fig 2B, lanes 9 through 11), indicating that these proteins are not present in nuclear extracts of the Kcl22 cell line.

Because the expression of C/EBPα and C/EBPε partly overlaps during myeloid differentiation and because both proteins can bind to the same DNA motif, we studied their relative DNA binding affinities to the C/EBP binding site of the neutrophil elastase promoter. Decreasing amounts of labeled oligonucleotides representing the C/EBP site were titrated with a constant amount of COS-1 cell extract expressing the respective C/EBP protein, and the bound complexes were separated from the free probe by EMSA (Fig 3A). The amounts of bound and free probe were quantitated with an Ambis imaging system (Ambis Inc, San Diego, CA). The values were plotted as bound/free versus bound, and the results were used to determine the dissociation constant, kd (kd = −1/slope). The kd for C/EBPα was 0.65 nmol/L and the kd for C/EBPε was 4.2 nmol/L (Fig 3B and C), showing that C/EBPα had a 6.5-fold higher affinity than C/EBPε to these C/EBP binding sequences.

The transactivation potential of C/EBPε isoforms p32 and p30 were initially examined using the promoters of the neutrophil elastase, G-CSF receptor, and mim-1 genes in heterologous cells. Expression plasmids for either C/EBPε p32 or p30 were cotransfected with promoter-luciferase reporter constructs into CV-1 cells, which do not express endogenous C/EBP proteins. Levels of C/EBPε isoforms p32 and p30 proteins after transfection with these expression vectors were shown to be similar by Western blotting of protein extracts from transfected cells (Fig 1, lanes 1 and 2). C/EBPε isoform p32 activated transcription from the neutrophil elastase promoter by 1.8-fold compared with C/EBP site mutants of the wild-type promoters. The mim-1 promoter was activated by 2.5-fold and the G-CSF receptor promoter by 1.6-fold (Fig 4A). These results are the average of three separate experiments. In all cases, the C/EBPε isoform p30 activated the promoters less efficiently than did the p32 isoform. For comparison, the same experiments were performed with C/EBPα. In CV-1 cells, C/EBPα was more active than C/EBPε for each of the promoter-reporter gene constructs (2- to 4-fold activation; Fig 4A).

Because the overall reporter gene activity for each of the constructs was low in CV-1 cells, we used Jurkat cells, a hematopoietic cell line, to confirm a potential, concentration-independent, in vivo difference in transcriptional activation potential between C/EBPε p32 and p30. We cotransfected Jurkat cells with expression plasmids (330 ng) for either C/EBPε p32 or p30 with either the mim-1 or neutrophil elastase promoter luciferase construct. After 48 hours, we measured the reporter gene activity in cytoplasmic lysates and determined the C/EBPε expression level in the nuclear lysates (Fig 4B). Reproducibly, C/EBPε p32 was threefold to fourfold more active than p30 on the mim-1 promoter and 1.5-fold more active than p30 on the neutrophil elastase promoter. In both cases, the expression levels of p32 and p30 were similar in the transfected samples (Fig 4C). Dose-response experiments using between 125 and 1,000 ng of the expression vector and 1 μg mim-1 reporter plasmid showed that the maximal effect on reporter gene activity was reached with expression plasmid concentrations as low as 125 to 250 ng. The rank order of transactivation efficiency was C/EBPα > C/EBPε p32 > C/EBPε p30 (Fig 4D). C/EBPε p32 was more potent than C/EBPε p30 at each concentration of the expression vector.

To determine if C/EBPε could activate transcription from these promoters in myeloid cells, the activation of the neutrophil elastase was examined in Kcl22 and U937 cells. As demonstrated (Fig 2B), the only C/EBP family member binding to the neutrophil elastase promoter in Kcl22 cells was C/EBPε. The wild-type neutrophil elastase promoter construct was 7.7-fold more active than the empty vector, p19Luc, in Kcl22 cells and 5.5-fold more active in U937 cells. In both cell lines, the NE promoter with a mutation in the C/EBP site was 30% to 50% less active than the wild-type promoter. Taken together, these data demonstrate that C/EBPε can contribute to the transactivation of the neutrophil elastase promoter in myeloid cells (Fig 5).

c-myb is a hematopoietic transcription factor known to cooperate with C/EBP proteins. It is highly expressed in Jurkat and Kcl22 cells (data not shown). A number of myeloid promoters have c-myb binding sites adjacent to C/EBP sites. We used the promoters from the neutrophil elastase and mim-1 genes to investigate the potential cooperation of C/EBPε p32 and p30 isoforms with c-myb. c-myb alone activated the neutrophil elastase promoter about twofold. The C/EBPε p32 isoform plus c-myb activated the neutrophil elastase promoter 10-fold in comparison to the empty expression vectors (Fig 6A). The C/EBPε p30 plus c-myb activated the same promoter sevenfold. These results indicate that both C/EBPε isoforms cooperatively activated the NE promoter with c-myb. The combination of both factors was 1.5-fold to twofold higher in activity than an additive effect. Mutation of either the C/EBP or myb sites in the neutrophil elastase promoter resulted in a loss of cooperativity between the factors (Fig 6A). This demonstrated that binding of C/EBPε to the promoter was essential for a significant transcriptional activation. The insertion of 5 bp between the C/EBP and the myb sites to rotate the relative position of the binding sites on the double helix did not change the cooperativity. Insertion of 10 bp slightly reduced cooperativity (Fig 6B).

A similar cooperative effect on transactivation of the mim-1 promoter was observed (Fig 6C). The C/EBPε isoform p32 plus c-myb activated the promoter 20-fold, C/EBPε p30 plus c-myb by 16-fold, and C/EBPα plus c-myb by 37-fold. Again, both C/EBPε p32 and p30 cooperated with c-myb in transcriptional activation. Together, the combination was twofold to threefold more active than a simple additive effect.

To analyze the structural and functional aspects involved in the cooperativity between C/EBPε and c-myb, we cotransfected various amino-terminal C/EBPε truncation mutants with c-myb and the neutrophil elastase promoter reporter construct (Fig 7). Suprisingly, a truncated C/EBPε protein (aa 118-281) that lacked the complete transactivation domain still cooperatively activated transcription from the promoter with c-myb, although at much lower levels than the full-length C/EBPε (Fig7). The truncation mutants alone did not transactivate the neutrophil elastase promoter (data not shown). This result implicates the carboxy-terminal half (DNA binding domain and leucine zipper) of C/EBPε in the cooperativity with c-myb.

The transcriptional cooperativity between C/EBPε and c-myb could occur via either indirect or direct interactions. We tested whether both factors could physically interact using pulldown assays. c-myb was pulled down by the MBP-C/EBPε fusion, but not by MBP alone (Fig 8A). In the reciprocal experiment, C/EBPε was pulled down by GST-c-myb but not by GST alone (Fig 8A). The same result was obtained with C/EBPε expressed in COS-1 cells or in vitro synthesized, ³⁵S-methionine labeled C/EBPε p32/p30 protein (data not shown). To define further the interacting domains, we used three GST fusion proteins representing different regions of c-myb: (1) the DNA binding domain (aa 1-185), (2) the DNA binding domain and the transactivation domain (aa 1-325), and (3) the negative regulatory domain (aa 326-636). Pulldown assays showed that all ³⁵S-methionine–labeled C/EBPε isoforms (p32, p30, p27, and p14) interacted with the GST-c-myb fusions 1-185 and 1-325 containing the DNA binding domain of c-myb. No interaction ocurred with either the GST-c-myb fusion 326-636 or the GST control. Furthermore, interaction of c-myb with all C/EBPε isoforms indicated that the carboxy-terminal half of C/EBPε, which is common to all isoforms, is sufficient for the interaction (Fig 8B).

Transcriptional cooperativity between v-myb and C/EBPβ has been attributed to interaction with the coactivator protein, CBP/p300. To investigate a possible interaction between C/EBPε p30 and CBP/p300, we performed pulldown assays using MBP-C/EBPε as bait and CBP expressed in cos-1 cells as input using the same techniques as those described above. No in vitro interaction between CBP and C/EBPε p30 was detected (Fig 8C).

Regulation of eukaryotic transcription is a highly complex process involving chromatin accessibility, basal transcriptional machinery, and the interplay of ubiquitously expressed and lineage-restricted factors. C/EBPε has a highly restricted pattern of expression limited predominately to the granulocytic lineage.30 Therefore, it is a good candidate for the regulation of lineage-restricted target genes in granulocytic cells. Because of the high degree of homology of the DNA binding domain between C/EBPε and other C/EBP family members and published data for the rat homolog CRP1,10 we reasoned that C/EBPε can bind to the same C/EBP consensus sites. Although we demonstrated binding to the C/EBP sites of the neutrophil elastase and G-CSF receptor promoters, the binding affinity was lower for C/EBPε than for C/EBPα. Further studies are needed to clarify whether homodimers or possibly heterodimers of C/EBPε can bind with higher affinity to other DNA motifs.

The differential upregulation of C/EBPε p30 in NB4 cells treated with retinoids suggests a separate functional role for each isoform in myeloid differentiation. Although both C/EBPε p32 and p30 contain the previously mapped transactivation domain,18 our data show that they differ in their potency by which they activate target promoters. C/EBPε p32 was a significantly stronger transactivator of the mim-1 and neutrophil elastase promoters. We hypothesized that the NH₂-terminal 32 amino acids may be important for interacting with additional proteins involved in the transcription of target genes of C/EBPε p32, but not p30.

The overall low transcriptional activation potential of C/EBPε in heterologous cells could be a consequence of either low affinity for the selected sites or an indication that other factors are required either for cooperation with or activation of C/EBPε in myeloid differentiation. In two model systems, we showed that a stronger transactivation can be mediated by the cooperation of C/EBPε with the hematopoietic transcription factor c-myb. For the first time, we demonstrated that a C/EBP protein can directly interact with c-myb in vitro. Interacting regions are the DNA binding domain of c-myb and the carboxy-terminal half of C/EBPε, common to all four C/EBPε isoforms. The significance of this finding is supported by our functional studies using amino-terminal truncation mutants of C/EBPε in transient transfections with c-myb which suggested an important functional role for the carboxy-terminal half of C/EBPε in the cooperation with c-myb. Mink et al32previously reported the interaction between the DNA binding domains of avian myeloblastosis virus v-myb and C/EBPβ. We conclude that the three mutations in the DNA binding domain of AMV v-myb (aa 91, 106, and 117), although important for differential binding to DNA motifs in comparison to E26 v-myb and c-myb,44 do not affect their binding to C/EBP proteins. However, the small reduction of cooperativity achieved by the insertion of 10 bp between the C/EBP and c-myb binding sites of the neutrophil elastase promoter suggests an additional mechanism. Recently, studies have shown that C/EBPβ interacted with the coactivator protein p300/CBP, which was important for the cooperation between v-myb and C/EBPβ.33 We did not observe an interaction between C/EBPε p30 and CBP in pulldown assays. Additional studies will clarify whether differences exist among C/EBPε isoforms and their interaction with coactivator proteins.

A cooperation between C/EBPε and c-myb may be relevant for target genes expressed in promyelocytes. Our data suggest a role for C/EBPε in the transcriptional regulation of the neutrophil elastase promoter. This promoter is transcriptionally regulated by members of at least three transcription factor families: C/EBP, myb, and ets factors. If multiple family members with similar binding capacity are expressed in one cell type, predicting which factor is most important in vivo is difficult. The ets family members GABP and PU.1 are both expressed in myeloid cells. Recently, studies showed that GABP is a significantly more potent activator of transcription from the neutrophil elastase promoter than PU.1, suggesting that GABP is the important ets factor in vivo.45 Also, C/EBPα and C/EBPε are coexpressed in myeloid cells expressing neutrophil elastase. Both factors can bind to the promoter and synergize with c-myb. The relative contributions of C/EBPα and C/EBPε to the expression of the neutrophil elastase gene in normal myeloid differentiation remain to be elucidated. Interestingly, forced overexpression of C/EBPε in NB4 cells increased clonal growth,2 a finding possibly related to its capacity to cooperate with c-myb, a transcription factor known to be involved in the regulation of hematopoietic cell proliferation.46 

In conclusion, p32 and p30 isoforms of C/EBPε act as transcriptional activators; and their potency is markedly enhanced by c-myb. Another partner may be required for efficient transcriptional activation by C/EBPε p30 in late myeloid differentiation.

The authors thank Dr Kleanthis Xanthopoulos for his helpful suggestions and his generosity in providing reagents.