Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML.

Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference.

Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D).

Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation.

Figure 1

View largeDownload slide

Figure 1

View largeDownload slide

Close modal