Circulating Exosomal MicroRNA-21 As a Potential Biomarker That May Predict Response to Azacitidine Treatment in Myelodysplastic Syndromes,

Abstract 3804

Prognostic factors for response and survival in patients with myelodysplastic syndromes (MDS) treated with azacitidine (AZA) remain largely unknown. Identification of molecular biomarkers in MDS is needed to predict clinical outcomes and help stratify MDS patients for epigenetic therapy. MicroRNA(miR)-21 has been recognized to be implicated in carcinogenesis, resistance to chemotherapy, and regulation of DNA methylation. A several prognostic studies found that a higher miR-21 expression was significantly associated with advanced diseases and worse outcomes in a variety of cancers. MicroRNA profiling of circulating tumor exosomes could potentially be used as surrogate diagnostic markers. Therefore, we evaluated the expression level of miR-21 in exosomes isolated from sera of patients with MDS and analyzed the association between exosomal miR-21 level and the response to AZA treatment and prognosis. Among 63 MDS cases enrolled in this study, WHO classification was RA/RARS in 19.1%, RCMD in 31.7%, RAEB-1 in 19.1%, RAEB-2 in 19.1%, and MDS-U in 11.0%. IPSS risk group was low in 7.5%, intermediate-1 in 60.3%, intermediate-2 in 28.6%, and high in 3.2%. AZA was administered subcutaneously with an initial dose of 75 mg/m²/day for 7 days every 28 days. Patients received AZA for a median of 6 cycles (range, 1–12). Response was evaluated after 4 cycles of AZA by blood count, marrow study, and cytogenetic analysis. CR, PR, marrow CR, stable disease (SD), hematologic improvement (HI), and progression were defined according to IWG 2006 criteria. Total RNA was isolated from exosomes, which were obtained from patients' serum using the Exoquick exosome precipitation solution. Serum was obtained at initial diagnosis, and after 4^th, 8^th cycles of AZA treatment. Quantitative RT-PCR was performed using SYBR^RRT-PCR method. miR-21 primer was: forward GCCCGCTAGCTTATCAGACTGATG, reverse GTGCAGGGTCCGAGGT. RNU6B was taken as reference gene for exosomal miR normalization. Relative level of the circulating miR-21 was determined using the comparative CT (2^−ΔΔCT) formula. With AZA treatment, the overall response rate was 58.7% (CR in 9.5%, PR in 3.2%, and HI in 46.0%). Baseline level of serum exosomal miR-21 was significantly higher in MDS patients compared with healthy volunteers (p <0.001). Serum miR-21 level was independent of age, sex, and IPSS risk group. Circulating miR-21 level prior-AZA therapy was significantly higher in the non-responder group compared to the AZA responder group (CR/PR/HI) (466.1±127.3 vs 31.8±14.3, p <0.001). The cut-off level of higher miR-21 was determined by ROC analysis. The response rate (including HI) was significantly lower in the higher miR-21 patients group (p< 0.005). We found that patients with higher level of circulating exosomal miR-21, compared with patients with lower level, had a significantly shorter median overall survival (10.7 vs 22.8 month, respectively, p =0.001) and significantly shorter median progression-free survival (14.0 vs 20.0 months, respectively, p =0.003). In multivariate analysis, high miR-21 level prior to AZA treatment was an independent risk factor for lower overall survival (hazard ratio 16.12, 95% CI 1.64–159.2, p< 0.01). We demonstrated for the first time that the circulating exosomal miR-21 is upregulated in MDS and its levels can be considered as a potential biomarker that may predict response to AZA treatment. Although the clinical potentiality of circulating exosomal miR-21 as biomarker in MDS will be prospectively validated in a large cohort of patients, these findings may be useful for directing AZA treatment, leading to improving treatment response and outcomes.