Analysis of GATA1 mutations within the subpopulations of blasts in a patient (TMD2) with Down syndrome. All patient samples were used with consent obtained by the Italian Association for Paediatric Oncology (AIEOP), and the study was approved by the North East London Health Authority's ethics committee. Peripheral-blood samples were taken 2 days after birth, with clinical signs of myeloproliferative disorder (a white blood cell count of 175 × 10³; morphology AML-M7; 50% blasts; karyotype 47XX⁺21). All other patients (TMD “n”), shown as amplification controls, were described for their GATA1 mutations in a previous report.²  The immunophenotyping study of patient-TMD2 blasts demonstrated that approximately 60% were CD34⁺, and most blasts also stained positive for CD7, CD33, CD61, CD41 and CD42a. Cells were sorted (> 98% pure, tested in an EpicsXL [Beckman-Coulter, High Wycombe, Bucks, United Kingdom]) using monoclonal antibody CD34 fluorescein isothiocyanate (FITC) and FACSVantage SE (Becton Dickinson, Plymouth, Devon, United Kingdom). RNA (RNABee; Biogenesis, Poole, Dorset, United Kingdom) and DNA were isolated using standard protocols. RT-PCR analysis was performed using GATA1 primers E1F (GATCACACTGAGCTTGCCAC) and E3R (TCCCCTCCATACAGTTGAGC). PCR from genomic DNA was performed with primers I1F (GGATTTCTGTGTCTGAGGAC) and I2R (CCAACAGCACTCAGCCAATG). PCR products were cloned using the TA cloning kit from Invitrogen (Paisley, Glasgow, United Kingdom), and sequencing was carried out with reagents from Applied Biosystems (Warrington, Cheshire, United Kingdom) on an ABI 3100 Genetic Analyzer. (A) Summary of different GATA1 mutations in patient TMD2. ^*Completely negative in genomic DNA by allele-specific PCR (see panel D). ^**Only detectable in genomic DNA. (B) Agarose-gel electrophoresis of RT-PCR products from the following samples: (1) TMD2 presentation, (2) TMD2 CD34^-,(3) TMD2 CD34⁺, (4) TMD7 presentation, (5) TMD3 CD34^-, (6) TMD3 CD34⁺, (7) non-leukemic DS cord blood CD34^-, (8) non-leukemic DS cord blood CD34⁺, (9) normal cord blood CD34^-, (10) normal cord blood CD34⁺, (11) minus RT, (12) H₂O. A short, 99-bp PCR product lacking exon 2 (spliceΔ-exon 2) can be seen in all samples. This product is physiologically present.⁴  Full-length GATA1 transcripts were present in the presentation of patient TMD2 and that patient's CD34^- cells. CD34⁺ cells from patient TMD2 lacked the full-length product. Another patient, TMD7, also demonstrated spliceΔ-exon 2 as the only transcript. The complete absence of exon-2-containing transcripts is not a CD34⁺-cell-specific phenomenon or sorting artifact, as CD34⁺ cells sorted by the same lab from patient TMD3 and cord-blood samples contained a full-length transcript (lanes 5-10). No splice-defect-causing mutations were detected in genomic DNA sequences from CD34⁺ cells from the middle of exon 1 through the entire length of intron 1-exon 2-intron 2-exon 3 (a total of 5630 bp). (C) Cloning and sequencing of PCR products and examples of mutations that were detected. The insertions are underlined. Only part of dup34 is displayed. The positions of the mutations are according to accession number NM_002049. (Ci-iii): RT-PCR from patient-TMD2 CD34^- cells. (iv) RT-PCR from patient-TMD2 CD34⁺ cells. (D) Mutation dup34 allele-specific PCR from genomic DNA of the following samples: lanes 1, 5: patient-TMD2 presentation; lanes 2, 6: patient-TMD2 CD34⁺ cells; lanes 3, 7: patient TMD1; lanes 4, 8: H₂O. For lanes 1-4, primers used were GATA1-dup34 (AGCTTCCTCCACTGCCTGAG) and I2R. Lanes 5-8 show control PCR for an unrelated gene with primers SAMSN1F (AGGCAAACCGAAGGAGTAAC) and 1R (TCGGTGTTTCCATTTACATGC). Underlined is the dup34 of exon 2 of GATA1. The arrow indicates the allele-discriminating primer. All PCR reactions had 40 cycles.