Abilities of C-terminal AML1 mutant proteins to bind DNA and to heterodimerize with CBFβ. (A) DNA binding potential of AML1 mutants was analyzed by EMSA using nuclear extract from Cos-7 cells transfected with wild-type AML1 or mutated AML1 expression plasmid vectors. The oligonucleotides used as competitors were as follows: W, containing one wild-type AML1 binding site (CGAGTATTGTGGTTAATACG); and M, containing one mutated AML1 binding site (CGAGTATTGTTAGTAATACG). Equal expression of each mutant was demonstrated by immunoblot analysis (WB) using a FLAG antibody, as shown in the lower panel. An arrow indicates supershifted bands. (B) Heterodimerization ability of AML1 mutants with CBFβ. Cos-7 cells were cotransfected with an expression vector containing CBFβ cDNA and with vectors containing either wild-type AML1 or mutated AML1 cDNA. The expression levels of AML1 in total cell lysates were detected by immunoblot analysis with an anti-FLAG antibody (upper panel). Cell lysates were immunoprecipitated (IP) with an anti-FLAG antibody, and then proteins were detected by immunoblot analysis (WB) using an anti-CBFβ antibody (lower panel).