Effect of ST1926 and CD437 on the mRNA levels of a number of genes in NB4 cells: validation of the microarray results. NB4 cells (150 000/well) were treated with vehicle (control), ST1926, and CD437 at the indicated concentrations for 4 hours. Total RNA was extracted and subjected to Northern blot analysis using the indicated cDNAs as radioactive probes. Probes were amplified by RT-PCR from the total RNA extracted from NB4 cells using the following amplimers: NM_006281 = 5′GACCATGGTGATAAACAGTGAGG 3′ (sense oligonucleotide), 5′TGCATCCATCGCATCCAGAATGG 3′ (antisense oligonucleotide) NM_001416 = 5′CCGAGAAGATGCATGCTCGAGAT 3′ (sense oligonucleotide), 5′GGTCAGCAACATTGAGGGGCATT 3′ (antisense oligonucleotide) NM_002699 = 5′GTTCGCCAAGCAGTTCAAGCAGC 3′ (sense oligonucleotide), 5′CTTGAGAAAGTGGCTCTCGAGCG 3′ (antisense oligonucleotide) NM_000986 = 5′TCCTTTCCAAGAGGAATCCTCGG 3′ (sense oligonucleotide), 5′TTTCCACCAACTCGGGGAGCTGA 3′ (antisense oligonucleotide) NM_021029 = 5′TGGTTAACGTCCCTAAAACCCGC 3′ (sense oligonucleotide), 5′GAACTGGATCACTTGGCCCTTTC 3′ (antisense oligonucleotide) NM_004718 = 5′TAGTGGCTTCACGCAGAAGTTGG 3′ (sense oligonucleotide), 5′GTTTTTGGGCTGCGAAGCCATGT 3′ (antisense oligonucleotide) For each Northern blot, an equivalent amount of RNA was added in each lane as indicated by the ethidium bromide staining of the 18S RNA. The results confirm the data illustrated in Table 2 for a number of selected genes.