Identification of the P_2X1del receptor.

(A) Schematic cDNA representation of 2 P_2X1 receptor homologs (P_2X1wt, the wild-type clone, and P_2X1del, the deletion clone). PCR amplification using P_2X1-derived ORF primers (S or 5′ sense⁶⁰³ATCCGCACGGGCAAGTGTGT and AS or 3′ antisense,¹⁰⁵⁹GCCTGGCAAACCTGAAGTTG) to amplify a partial P_2X sequence revealed the homologous wild-type P_2X1 receptor and an in-frame 51-bp deletion clone (P_2X1del). Lines above the figure represent the expected 450-bp P_2X1wt sequence and the identified 400-bp P_2X1del sequence. Sequence numbering is relative to a P_2X1 receptor (accession number, X83688). ORF primers include 5′ BamHI and 3′ XbaI sites facilitating subcloning into pcDNA3.1 and subsequent transfection into 1321 cells. Within the 51-bp deletion variant is a glycosylation site indicated in bold, underlined type. The 51-bp deleted DNA sequence is shown with its deduced amino acid sequence relative to its location with the 2 transmembrane regions (TM1 and TM2), the location of 2 proposed extracellular cysteine loops, and a pore site (H1). GKAKRK is an amino acid antibody determinant deduced by the PCgene program and used for antibody production. (B) Comparison of PCR amplification products using CMK 11-5 cells and platelets. Primers (S and AS) were used to amplify a partial sequence in the extracellular portion of the P_2X1wt receptor. Besides the expected amplicon of 450 bp, a band of 400 bp was observed. PCR results with CMK 11-5–derived mRNA showed approximately equal or greater amplification of the 450-bp band (wild-type P_2X1 cDNA) than the 400-bp band (deletion P_2X1 cDNA) (compare lanes 1-4), whereas platelets (lane 5) demonstrated a greater proportion of the 400-bp amplicon. Varying the annealing temperature for the PCR reaction at 50°C, 55°C, or 60°C (lanes 1-3, respectively) did not vary the intensity of the bands. PCR products were subcloned into pCRII and were sequenced for confirmation. (C). Selective PCR amplification of the P_2X1del receptor in platelets. Two primers (sense primer (S2)⁶⁸⁸ACATCCCGCGCATCAGCT and antisense primer (AS1)¹⁰⁸²GCCTGGCAAACCTGAAGTTG) were used to selectively amplify platelet P_2X1del cDNA (note that AS and AS1 primers are identical). An 11-base sequence (ACATCCCGCGC) and a 7-base sequence (ATCAGCT) span the 51-bp deletion sequence and are found only in the P_2X1del cDNA. (D) Agarose gel of PCR amplicon. Using the PCR primer pair (S2 and AS1), an approximately 371-bp PCR band from both cDNA isolated from platelets (lane 1) and from a 400-bp partial P_2X1del cDNA sequence inserted into the pcDNA3.1 plasmid (lane 2) are amplified. PCR reactions used an annealing temperature of 60°C. Although an expected PCR reaction would result in 2 PCR products using the primers designated S1 and AS1—one of 451 bp for the P_2X1wt receptor and one of 400 bp for the P_2X1del receptor (see Figure 1B)—a single PCR product of approximately 371 bp using primers S2 and AS1 directly indicates the presence of the P_2X1del receptor. Lane 3 is a PCR reaction with the S2 and AS1 primers with a pcDNA3.1 plasmid containing irrelevant DNA.