Identification of T-cell–specific binding protein as GATA-3.

(A) Putative binding site for the GATA family in the RAG-2 promoter. Possible GATA binding site present in the −85/−56 RAG-2 promoter region is indicated by an arrow. The asterisk denotes a nucleotide identical with the consensus GATA family binding sequences 5′-TATC-3′. The TC in the putative GATA binding site was altered to AG (underlined) in the −85/−56 Gm. (B) Nuclear proteins binding to the RAG-2 promoter in T cells. EMSA was performed by incubating nuclear extract prepared from EL4 cells and the³²P-labeled probe containing GATA binding sites (5′-AAGCTTGATGCT- CTAGATAACGGGAGTAGCTCTAGATAACGGGGTCACAGTCAGTTACTCCCGT- TATCTAGAGCGTCACAGTCAGTTACTCCCGTTAGTCACAGTCAGTTACTCCC- GTTATCTAGAGCATCGAATTC-3′) in the presence of 4 mmol/L magnesium chloride (MgCl₂). C3 or C4 indicates a nuclear protein complex with probe DNA, and F indicates a free probe DNA. As a competitor, we used 100-fold or 400-fold molar excess of consensus binding sequences for GATA, the −85/−56 fragment, or the −85/−56 Gm. (C) The effect of anti–GATA-3 antibody on EMSA. EMSA was performed as described above in the presence of anti–GATA-3 or anti–c-Myb antibody. The asterisk denotes the band shifted with the anti–GATA-3 antibody. (D) Binding of GATA-3 to the −85/−56 region. EMSA was performed by incubating nuclear extracts prepared from 293T cell transfectants of GATA-3 and the ³²P-labeled −85/−56 fragment. C5 or C6 indicates a complex of a nuclear protein and probe DNA, and F indicates a free probe DNA. A 200-fold molar excess of the −85/−56 fragment and consensus binding sequences for GATA were used as competitors. We used 0.5 μg anti–GATA-3 antibody or control mouse IgG for the supershift analysis. The asterisk denotes the band shifted with the anti–GATA-3 antibody.