Effect of HDAC1 and NF-κB on TIPS. (A) Jurkat-LT cell transfection and luciferase assay were performed as previously described. Plasmids used were as follows: wild-type SHP-1 P2 promoter (wt-P2-Luc), 500 ng; wt Tax, 200 ng; HDAC1, 500 ng; and RelA, 30 ng, 100 ng, or 300 ng. TSA (100 ng/mL or 500 ng/mL) was added 24 hours before harvesting the cells. Cell lysates were assayed in triplicates for luciferase activity and values represent the mean ± SD of 2 experiments. The relative luciferase activity was normalized against basal SHP-1 P2 promoter luciferase reporter alone (set as 100). (B,D) Jurkat-LT cells were cotransfected with 500 ng wtP2-Luc, different amounts of wtTax plasmid, and siRNA against HDAC1 as indicated on X-axis. Cells were harvested 48 hours after transfection, and cell lysates were analyzed by luciferase assay (B) and by Western blot (D, anti-HDAC1, upper; and anti–β-tubulin, lower, from Santa Cruz Biotechnology catalog no. sc-7872 and sc-9104, respectively). A nonspecific siRNA was used as a control. (C) Effect of NF-κB on association of HDAC1 with Tax. Jurkat-LT cells (5 × 106) were transfected with 3 μg Flag-tagged Tax constructs (wt or M22 or M47) and 100 ng or 800 ng RelA (p65 of NF-κB) plasmid. Sixty hours later, cells were harvested and lysed in 1 × RIPA lysis buffer with protease inhibitors (catalog no. 1169-7498; Roche Diagnostics, Indianapolis, IN). The proteins in association with Tax were precipitated with anti-Flag M2 agarose beads (A2220; Sigma) and identified by Western blots using HDAC1 antibody (lane A, sc-7872; Santa Cruz Biotechnology), anti-RelA antibody (lane B, sc-372; Santa Cruz Biotechnology), or anti-Flag antibody (lane C for Tax detection, A8592; Sigma). As controls, Western blots were also performed using cell lysates without immunoprecipitation against HDAC1, RelA, and Flag (lanes D, E, and F, respectively). IP indicates immunoprecipitation; WB, Western blot. (E) CHIP analysis. Jurkat cells were transfected, using Amaxa kit VCA-1003, with 3 μg of WtTax, M22, or M47 Tax-expressing plasmids and a control pMaxGFP plasmid. Sixty hours after transfection, cells were harvested and CHIP assay was performed using Upstate kit (17-295). Primers for PCR analysis were as follows: F70, 5′AGTGCCACCCTGCTCTGCTTC3′; R00, 5′CCTGGGGGCTTCCGGAGAGG3′. Antibodies used here were as follows: (lane 1) anti-p65; (lane 2) anti-p50; (lane 3) anti-Tax; (lane 4) anti-HDAC1; (lane 0) rabbit isotype IgG control. (Left images; from top to bottom) GFP control, no transfection control, and input control. (A-E) Input DNA control from wtTax, M22, M47, GFP, and no transfection, respectively. + indicates positive PCR control with the pGL3-LC-P2 plasmid; −, no DNA template control. (Right images; from top to bottom) Jurkat cells transfected with wtTax, M22, and M47. (F) CHIP assay of histone H3-K9 deacetylation at P2 promoter in freshly isolated CD4+ T cells transfected with HTLV-1 proviral DNA (pACH-wtTax). (Lane 1) no antibody; (lane 2) anti-Tax; (lane 3) anti-HDAC1; (lane 4) anti–acetyl-H3-K9; (lane 5) anti-H3. Antibodies used for CHIP assays in panels E,F: from NIH-ARRRP: anti-Tax (Tab172); from Santa Cruz Biotechnology: anti-HDAC1 (sc-7872); anti–NF-κB (p65) (sc-372X); anti–NF-κB (p50) (sc-7178X); and rabbit control IgG (sc-2027); from Cell Signaling Technology: anti–acetyl-H3-K9 (catalog no. 9671) and anti-H3 (catalog no. 9715). Spaces were inserted into both panels D and F to indicate where the gel lanes were cut. Note that the gel images in each panel came from the same experiment.
