Fig. 3.
![Fig. 3. IFNα treatment fails to induce ISGF3 formation in HUT78R cells. IFNα–induced-ISGF3 complex formation was analyzed by gel shift assays using oligo probes. ISRE probe I: TTGGACTGCTGTTGGTTTCGTTTCCTC (left panel) and a longer version of the ISRE probe II: TTGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG (right panel). HUT78R and HUT78S cells were treated with (+) or without (−) IFNα (10,000 U/mL) for 5 minutes. Nuclear extracts were prepared and incubated with 32[P]-labeled probes for 15 minutes at 30°C and the binding mixture was subjected to electrophoresis followed by autoradiography. The arrows indicate the location of ISGF-3 complexes.](https://ash.silverchair-cdn.com/ash/content_public/journal/blood/91/2/10.1182_blood.v91.2.570/3/blod4024003.jpeg?Expires=1724274015&Signature=jekv1op7qqSU320xXd0E3WnczSc94a6WrPL51SDfHXACQywqoZYjEtfSqfbHAW7IWc3rDYSBIvj6sodS2IOIC9DGCDTG7tDuv3SOQJU~6hvo0ib1JgJoW2TaCyPQQ7VZMm4btS7gehu2vbGiBKWY-ewF~9iSqyvpZ5pvGgdg1~XyFZcF~rsnCNrd5oLk2yt6RmUVYcBFyPSwBe89K0pqa3Vlc3E0XxZGysNrbv8fKpZ8PHcsf4pWfvKuAsBwz0mcSAMIaSKLu10lXwndsdPp5lTSHECXAuRphY02oOdsxDO0qkNf9mAChU2aEOdmV6Uz3kCiD1IDBb2uhBavaABblw__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA)
IFNα treatment fails to induce ISGF3 formation in HUT78R cells. IFNα–induced-ISGF3 complex formation was analyzed by gel shift assays using oligo probes. ISRE probe I: TTGGACTGCTGTTGGTTTCGTTTCCTC (left panel) and a longer version of the ISRE probe II: TTGGACTGCTGTTGGTTTCGTTTCCTCAGAAGGGAGGAG (right panel). HUT78R and HUT78S cells were treated with (+) or without (−) IFNα (10,000 U/mL) for 5 minutes. Nuclear extracts were prepared and incubated with 32[P]-labeled probes for 15 minutes at 30°C and the binding mixture was subjected to electrophoresis followed by autoradiography. The arrows indicate the location of ISGF-3 complexes.
