Hybrid D-CE and CE-D PCR of reticulocyte transcripts from D^VI phenotype individuals. cDNAs derived from reticulocytes of donors with the indicated phenotypes were amplified between two sets of primers in which one oligonucleotide is specific of the RHD gene and the other one of the RHCE gene. Set 1: 5′TTTGTCGGTGCTGATCTCAGTGGA3′ (RHD, exon 3); 5′GAACACGTAGAAGTGCCTCAG3′ (RHCE, exon 4). Set 2: 5′GGATGTTCTGGCCAAGTG3′ (RHCE, exon 5); 5′AGGTACTTGGCTCCCCCGGAC3′ (RHD, exon 6). PCR products were resolved by electrophoresis on 2.5% agarose gel and characterized by hybridization with the Rh cDNA probe.