Figure 2
Figure 2. miR-29a binds to 3′UTR of SKI and is associated with low Ski expression in primary AML cells. (A) Scheme of the luciferase constructs. The 3′UTR of Ski was subdivided into 3 approximately 450-bp overlapping fragments (1/2 bp 1-465, 3/4 bp 386-867, 5/6 bp 756-1252) and cloned in the 3′direction of the luciferase gene in the pGL3 control vector. A putative binding site for miR-29a in fragment 5/6 of Ski 3′UTR at bp 1066-1088 is shown. Underlined are complementary parts of miR-29a and SKI 3′UTR. (B) miR-29a targets the 3′UTR of Ski in vitro. The empty luciferase reporter plasmid (ev) or luciferase reporter plasmids carrying the 1/2, 3/4, or 5/6 fragment of the 3′UTR of Ski (1/2-UTR, 3/4-UTR, 5/6-UTR) were cotransfected with scrambled precursor miRNA or miR-29a precursor and with pRL-TK-Luc in HeLa cells. Twenty-four hours after transfection, Firefly luciferase activity was measured. Black bars indicate miR-scrambled; gray bars, miR-29a. Results are representative of 3 individual experiments with 5 replicates. Normalized Renilla luciferase expression in cells transduced with the different SKI-3′UTR plasmids and miRna-scrambled was set at 100%. Values are mean ± SEM. (C) miR-29a targets its predicted binding site in SKI-3′UTR. The luciferase reporter plasmids 130bpWT-UTR or 130bpMUT-UTR contained a 130-bp fragment of 5/6-UTR that flanked the putative binding site in 5/6 at position 1066-1088. The original putative binding sequence CUUAGAAACCCCCUCUGGUGCCU was mutated to CUUAGCAACCTCCUCUCGUACCU. The changed bases are underlined in Figure 2A. HeLa cells were cotransfected with scrambled precursor miRNA (black bars) or miR-29a precursor (gray bars) and with pRL-TK-Luc. Twenty-four hours after transfection, Firefly luciferase activity was measured. Results are representative of 3 individual experiments with 5 replicates. Normalized Renilla luciferase expression in cells transduced with the different 3′UTR-plasmids and miRNA-scrambled was set at 100%. Values are mean ± SEM. (D) miR-29a and Ski expression are inversely associated in human AML samples. Statistical analysis of Ski Western blot data and miR-29a quantitative RT-PCR data showed a significant correlation (P = .020) of high miR-29a expression and low Ski expression in AML patient samples (n = 21).

miR-29a binds to 3′UTR of SKI and is associated with low Ski expression in primary AML cells. (A) Scheme of the luciferase constructs. The 3′UTR of Ski was subdivided into 3 approximately 450-bp overlapping fragments (1/2 bp 1-465, 3/4 bp 386-867, 5/6 bp 756-1252) and cloned in the 3′direction of the luciferase gene in the pGL3 control vector. A putative binding site for miR-29a in fragment 5/6 of Ski 3′UTR at bp 1066-1088 is shown. Underlined are complementary parts of miR-29a and SKI 3′UTR. (B) miR-29a targets the 3′UTR of Ski in vitro. The empty luciferase reporter plasmid (ev) or luciferase reporter plasmids carrying the 1/2, 3/4, or 5/6 fragment of the 3′UTR of Ski (1/2-UTR, 3/4-UTR, 5/6-UTR) were cotransfected with scrambled precursor miRNA or miR-29a precursor and with pRL-TK-Luc in HeLa cells. Twenty-four hours after transfection, Firefly luciferase activity was measured. Black bars indicate miR-scrambled; gray bars, miR-29a. Results are representative of 3 individual experiments with 5 replicates. Normalized Renilla luciferase expression in cells transduced with the different SKI-3′UTR plasmids and miRna-scrambled was set at 100%. Values are mean ± SEM. (C) miR-29a targets its predicted binding site in SKI-3′UTR. The luciferase reporter plasmids 130bpWT-UTR or 130bpMUT-UTR contained a 130-bp fragment of 5/6-UTR that flanked the putative binding site in 5/6 at position 1066-1088. The original putative binding sequence CUUAGAAACCCCCUCUGGUGCCU was mutated to CUUAGCAACCTCCUCUCGUACCU. The changed bases are underlined in Figure 2A. HeLa cells were cotransfected with scrambled precursor miRNA (black bars) or miR-29a precursor (gray bars) and with pRL-TK-Luc. Twenty-four hours after transfection, Firefly luciferase activity was measured. Results are representative of 3 individual experiments with 5 replicates. Normalized Renilla luciferase expression in cells transduced with the different 3′UTR-plasmids and miRNA-scrambled was set at 100%. Values are mean ± SEM. (D) miR-29a and Ski expression are inversely associated in human AML samples. Statistical analysis of Ski Western blot data and miR-29a quantitative RT-PCR data showed a significant correlation (P = .020) of high miR-29a expression and low Ski expression in AML patient samples (n = 21).

Close Modal
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal