GBS engagement of Siglec-9 attenuates human neutrophil immune functions. (A) GBS attenuates neutrophil oxidative burst via engagement of Siglec-9. BSAb- or NBSAb-treated neutrophils were labeled with dichlorofluorescin-diacetate at a final concentration of 20 μM and incubated for 20 minutes at 37°C. GBS COH1 WT was added at a multiplicity of infection (MOI) of 10 and incubated for 30 minutes at 37°C. Oxidative burst was measured using FACS analysis. MFI indicates mean fluorescence intensity. (B) GBS reduces neutrophil release of granule proteases by engagement of Siglec-9. Neutrophils were pretreated with BSAb or NBSAb (10⁶ cells in 50 μL mixed with GBS COH1 bacteria at an MOI of 10 in triplicates) and incubated at 37°C for 30 minutes. Tubes were centrifuged at 1000g for 5 minutes and the supernatant collected into wells of a 96-well plate; 0.5 μL of MeOSuc-Ala-Ala-Pro-ValNmec dissolved in dimethyl sulfoxide at 20 mM was added to each well. After incubating at room temperature for 20 minutes, hydrolysis of the substrate was monitored spectrofluorometrically by change in absorbance at 405 nm. Baseline release of elastase by unstimulated neutrophils is set to 100%, and the graph shows a relative percentage release. (C,D) Production of NETs is attenuated GBS CPS engagement of Siglec-9. Antibody-treated neutrophils were incubated with bacteria at MOI 100 for 30 minutes at 37°C. NETs were stained using Cytox Orange and counted across the central transect of each well under the fluorescent microscope. The y-axis shows the number of NETs counted per transect of the wells. (E) Siglec-9 engagement by GBS blunts the up-regulation of mRNA expression of the inhibitory cytokine IL-10. GBS COH1 WT was added to antibody-pretreated neutrophils at an MOI 10 in a 6-well plate for 30 minutes at 37°C, and expression of IL-10 mRNA quantified with reverse-transcribed polymerase chain reaction primers forward (AACCTCCTCTCTGCCATCAA) and reverse (GGAAGACCCCTCCCAGATAG). (F) GBS engagement of Siglec-9 via its capsular Sia promotes resistance to neutrophil total killing. The y-axis shows percentage survival, ie, recovered colony-forming units (cfu) divided by inoculum cfu multiplied by 100. (G) GBS engagement of Siglec-9 via CPS Sia promotes resistance to neutrophil extracellular killing. Total and extracellular neutrophil killing assays were as described.²⁴  Cytochalasin D was added to antibody-treated neutrophils and mixed with GBS COH1 WT, GBS COH1 deltaNeuA (Sia minus),²⁵  or group A Streptococcus M1 strain at MOI 10, and incubated at 37°C. Part of each sample was plated at 5, 10, 20, and 30 minutes, and the surviving bacteria cfu counted the next day. The graph shows surviving cfu percentage at 30 minutes. Similar differences were seen at other time points.