High expression of endogenous GATA-2 correlates with quiescence of human cord blood (CB) cells. (A) Quiescent and cycling CD34⁺CD38⁻ cells were sorted from freshly thawed CB on the basis of low and high Pyronin Y staining, respectively. (B) Quantitative RT-PCR analysis from 2 independent samples showed higher expression of GATA-2 relative to HPRT in the quiescent G₀ cells. HPRT was expressed at similar levels in these subsets (data not shown). Error bars indicate SEM. (C) The bicistronic lentiviral expression construct in Figure 1E was used to drive enforced expression of FLAG-tagged GATA-2 and GFP. Transduced CD34⁺ cells selected on the basis of GFP expression (i) were used for quantitative RT-PCR for GATA-2 (ii) to show that expression of GATA-2 is higher in GFP^hi cells. (D) DNA-binding competency and expression level of FLAG–GATA-2 expressed in sorted GFP⁺ total CD34⁺ CB cells as assessed by electrophoretic mobility shift assay using ³²P-labeled GATA oligonucleotide (sequence, 5′ to 3′ TATTTTTATCTGATAGGAAGT). (E) Western blot showing expression level of lentivirally expressed GATA-2 in freshly isolated unstimulated CB CD34⁺ cells, or after transduction with vector or GATA-2. Expression relative to β-tubulin (normalized to ratio in vector-transduced cells) is shown below the blot. (F) CB CD34⁺ samples were split, infected with lentiviral vectors, and sorted 3 days later on CD34 and CD38 before staining with Hoechst and Pyronin Y. Hoechst 33342 and Pyronin Y staining profiles are shown for the indicated populations from a representative sample. The mean percentage of quiescent GFP⁺CD34⁺CD38⁻ (G) and quiescent GFP⁺CD34⁺CD38⁺ cells (H) falling in the G₀ gates is presented from 3 independent samples. Error bars indicate SEM. (I) CB CD34⁺ cells in culture in SCF, TPO, and Flt3L were washed to remove cytokines and left in culture overnight; a control culture had cytokines added back. Eighteen hours later the cells were fixed in ethanol and stained with Hoechst and Pyronin Y. (J) Enforced GATA-2 expression confers a profound growth defect. Transduced GFP⁺CD34⁺CD38⁻ cells were put into culture in SCF, TPO, and Flt3L and counted at intervals. Cell density per milliliter is shown from 1 of 3 representative experiments. (K) Cells were sampled at day 2 and day 11 and stained for annexin V by flow cytometry. Cells with enforced expression of GATA-2 were not more apoptotic than those expressing empty vector. Similar data were obtained throughout 4 replicate in vitro proliferation experiments. (L) The proliferative defect is predominantly observed in cells expressing high levels of GATA-2. Samples of transduced CD34⁺ cells with the highest and lowest levels of GFP expression were sorted and cultured as before. Cell density per milliliter is shown from a representative experiment.