Hypoxia and VHL expression regulate neutrophil phagocytosis. Following a 1-hour preincubation in normoxia (19 kPa), hypoxia (3 kPa), or normoxia at 4°C (binding control) neutrophils from healthy controls or patients with genotyped VHL disease were cocultured with heat-inactivated FITC-labeled streptococci and the uptake of FITC by neutrophils assessed by flow cytometry at 1 hour. (A) Representative histograms of uptake of FITC-labeled streptococci from VHL and control neutrophils in normoxia (pink line VHL, pale blue line control) and hypoxia (red line VHL, dark blue line control), with M2 indicating the region used to calculate the mean fluorescence. (B) Mean ± SEM of the geometric mean fluorescence values following ingestion of streptococci (* P < .05; ** P < .03; *** P < .001; n = 4). Detection of PHD1-3 mRNAs was performed on freshly isolated neutrophils by RT-PCR, using RNA isolated from patients 13 and 14 and 2 healthy controls (C). The following primer sequences were used: PHD1, forward 5′ AGAGAACCAGGAGGCAGAGC 3′, reverse 5′AAATGAGCAACCGGTCAAAG 3′; PHD2, forward 5′ GAGAAGGCGAACCTGTACCC 3′, reverse 5′ GCTCGTGCTCTCTCATCTGC 3′; PHD3, forward 5′ GCTTCCTCCTGTCCCTCATC 3′, reverse 5′ CAGAGCACGGTCAGTCTTCA 3′; β-actin, forward 5′ CTACAATGAGCTGCGTGTGG 3′, reverse 5′ GCACTCTTCCAGCCTTCCTT 3′.