Abilities of AML1 mutants to bind DNA and to heterodimerize with CBFβ.

(A) DNA binding potential of AML1 mutants analyzed by EMSA using nuclear extract from Cos-7 cells transfected with wild-type AML1 or mutated AML1 expression plasmid vectors. The oligonucleotides used as competitors were as follows: “W” containing one wild-type AML1 binding site (CGAGTATTGTGGTTAATACG); “M” containing one mutated AML1 binding site (CGAGTATTGTTAGTAATACG). (B) Heterodimerization ability of AML1 mutants with CBFβ. Cos-7 cells were cotransfected with an expression vector containing CBFβ cDNA and those containing either wild-type AML1 or mutated AML1 cDNA. Cell lysates were immunoprecipitated (IP) with anti–FLAG M2 antibody, and then proteins were detected by immunoblot analysis (WB) using anti-CBFβ antibody (top). The expression levels of CBFβ and AML1 in total cell lysates were detected by immunoblot analysis with anti-CBFβ antibody (upper middle) and anti–FLAG M2 antibody (lower middle), respectively. The AML1 expression levels also were analyzed by anti-AML1 antibody (bottom). The numbers of AML1 mutants (1-10) are shown in Figure 1.