Low levels of PRDM1β expression in B lymphoma cell lines. (A,B) PRDM1α and PRDM1β mRNA in DLBCL cell lines (OCI-Ly1, OCI-Ly2, OCI-Ly3, OCI-Ly4, OCI-Ly7, OCI-Ly8, OCI-Ly18 and SUDHL-6) and Burkitt lymphoma cell lines (Daudi and Namalwa) were quantified by Taqman reverse-transcriptase-polymerase chain reaction, normalized with beta-glucuronidase, and expressed as a percentage relative to U266. For PRDM1α mRNA quantification: forward primer, TCCAGCACTGTGAGGTTTCA; reverse primer, TCAAACTCAGCCTCTGTCCA; probe, ATGGACATGGAGGATGCGGATATG. For PRDM1β mRNA quantification: forward primer, CCCGAACATGAAAAGACGAT; reverse primer, ATAGCGCATCCAGTTGCTTT; probe, TCCAGAGGGGAGCTTCACCACTTC. In OCI-Ly3, PRDM1α mRNA is not detectable by the primers shown above because of a chromosomal inversion breakpoint at intron 2 of the PRDM1 gene. Error bars indicate SE. (C) Western blotting of total protein extracts using the ROS monoclonal anti-PRDM1 antibody. The positions for PRDM1α and PRDM1β are indicated. Asterisk marks the nonspecific band. Ponceau S staining of the membrane is shown for protein loading control. (D) Examples of immunoperoxidase staining on paraffin tissue sections for PRDM1 in U266 cells (i) and representative DLBCL cases (ii-iv). U266 cells show uniform strong staining, while all or most of the tumor cells in DLBCL are negative for or weakly express PRDM1. A few scattered PRDM1⁺ cells serve as internal controls for the DLBCL cases. The DLBCL cases shown have the immunohistochemical profile of non-GCB-type DLBCL. Micrographs were acquired with a Nikon Microphot SA microscope (Nikon Instruments, Melville, NY) and a SPOT Insight Color Mosaic QE 4.2 camera and image acquisition software system (Diagnostic Instruments, Sterling Heights, MI).