AKT induces full postprogenitor erythroid differentiation through a signal distinct from its survival signal. (A) FACS analysis of TER 119 and CD71 cell-surface expression within live GFP-positive wild-type TER 119^- (E14) fetal liver progenitor-derived cells after 36 hours of retroviral transduction with indicated constructs and cultured in the presence or absence of Epo on RetroNectin. Percentages for CD71⁺ TER 119⁺ (top right quadrant) and for CD71^-/low TER 119⁺ (bottom right quadrant) are shown. Representative plot from 5 independent experiments is shown. (B) Relative content of different erythroid subpopulations of the same experiments as in panel A. The P values (Student t test) are calculated from differences in CD71⁺ TER 119⁺ and CD71^- TER 119⁺ cells between active (AKT^*) or wild-type AKT-transduced cells. (C) Percentages of annexin V–positive cells in a fraction of live GFP-positive transduced cells from panel A; a representative of 3 independent experiments is shown. (D) Primary fetal liver progenitor (TER 119^-) cells were retrovirally transduced with retroviral vectors expressing shRNA targeting the following sequences: (AKT1 1700-1719) 5′AACAGTTCTCCTACTCAGCCA3′, (AKT1 2244-2271) 5′GATTCTTGTTCCTCTGTCAACCTCACTT3′ ²¹  or lamin A/C.²²  Supernatants of retroviral vectors with RNA polymerase III H1 promoter driving the expression of shRNA and containing no insert (lane 1), shRNA targeting AKT (lanes 2 and 3),²¹  or shRNA targeting lamin A/C (lane 4)²²  were used. Total cells were cultured in the presence of Epo (2 U/mL), SF (50 ng/mL), and IL-6 (50 ng/mL). Seventy-two hours after retroviral transduction, protein and RNA lysates were prepared from aliquots of the same samples for Western blot analysis (top panel, using indicated antibodies) and real-time PCR analysis (bottom panel). To minimize cell loss during the procedure, GFP-positive cells, in average 50%, were not FACS sorted in these experiments.