Figure 3.
CAR T-cell expansion in peripheral blood in patient 1. The horizontal axis represents time (days) in relation to CAR T-cell infusion, and the vertical axis represents vector copies per microgram of buffy coat DNA. We quantified the integrated genome of the retrovirus encoding the anti-CD19 CAR (axi-cel) by quantitative PCR.8 DNA was extracted from buffy coat samples with DNeasy Blood and Tissue Kit (Qiagen) as per the manufacturer’s instructions. DNA was amplified with primers and probes (IDT Technologies) complementary to specific sequences within the axi-cel vector. The sequences of the primers and probes were as follows: forward primer, 5′ attcgccagcctccacgaaa 3′; reverse primer, 5′ ggtcagtctggatttgagagc 3′; probe, 5′ FAM gggtctggaZENgtggctgggagt3′IBFQ. The standard curve was established using serial dilutions of the known quantity of the DNA encoding the transgene. We performed amplifications using the C1000 Touch Thermal Cycler (Bio-Rad) Real-Time PCR System as per the manufacturer’s instructions.