Sequencing primers*
Name . | Sequence (5′→3′) . | Length, bp . | Location . |
|---|---|---|---|
| ABO004s | gatgcctgaattacaaggcg | 20 | Intron 1, nt 12894 to 12913 |
| ABO005as | atgctccacctgctcttcc | 19 | Intron 3, nt 11 to 29 |
| ABO008s | acgtgtctggtgaatgtgtg | 20 | Intron 3, nt 1184 to 1203 |
| ABO013s | cagGATGGTCTACCCCCAG | 19 | Intron 4, nt 1684 to exon 5 nt 16 |
| ABO024as | ACAATGGGAGCCAGCCAAG | 19 | Exon 6, nt 266 to 284 |
| ABO026s | gctgaatcagagactctgag | 20 | Intron 4, nt 1473 to 1492 |
| ABO032s | CAGTTCAGGCTCCAGAACAC | 20 | Exon 6, nt 322 to 341 |
| ABO035as* | acctcaatgtccacagtcac | 20 | Intron 6, nt 46 to 65 |
| ABO037s | tcactgaccagagatagcag | 20 | Intron 6, nt 332 to 351 |
| ABO039s* | cgtccgcctgccttgcag | 18 | Intron 6, nt 1035 to 1052 |
| ABO042as | GGTGGCCCACCATGAAGTG | 19 | Exon 7, nt 418 to 436 |
| ABO105as* | tcccagagcccctggcag | 18 | 3′-UTR, nt 5 to 22 |
| ABO138s | CGCACTTCGACCTATGATCC | 20 | Exon 2, nt 45 to 64 |
| ABO139as | CAGGCTTCCTGGCATTAGAC | 20 | Exon 3, nt 122 to 141 |
| ABO140as | ctgtgttctcattctgcagC | 20 | Intron 3, nt 1433 to exon 4, nt 156 |
| ABO141s | AAGCCCCAGAAGTCTAATGC | 20 | Exon 3, nt 111 to 130 |
| ABO142as | gggaggcactgacattatac | 20 | Intron 4, nt 1 to 20 |
| ABO143s | ggacgggcctcctgcag | 17 | Intron 6, nt 983 to 999 |
| ABO145s | ctacactgggttcccaaatc | 20 | Intron 3, nt 306 to 325 |
| ABO147s | aagtgattctcctgcctcag | 20 | Intron 4, nt 330 to 349 |
| ABO149as | cccctcccatcaagagatg | 19 | Intron 3, nt 1110 to 1138 |
| ABO165as | aaccgccctctaataccttc | 20 | Intron 5, nt 52 to 71 |
| ABO186as | cagctactcaggaggctgc | 19 | Intron 4, nt 324 to 342 |
| ABO214as | GGTAGACCATCctgcaagcg | 20 | Intron 4, nt 1678 to exon 5, nt 11 |
| ABO217s* | ggcgccgtcccttcctag | 18 | 5′-UTR, nt 1866 to 1883 |
| ABO219s | ccccagctcaccattccatg | 20 | Intron 4, nt 851 to 870 |
| ABO274as* | cctgcggtagcggctccct | 19 | Intron 1, nt 33 to 51 |
| ABO296s* | ggaaacaaatcctacccctac | 21 | 5′-UTR, nt -3988 to -3968 |
| ABO297as* | gtgctgcctgtgcctgttac | 20 | 5′-UTR, nt -3664 to -3645 |
Name . | Sequence (5′→3′) . | Length, bp . | Location . |
|---|---|---|---|
| ABO004s | gatgcctgaattacaaggcg | 20 | Intron 1, nt 12894 to 12913 |
| ABO005as | atgctccacctgctcttcc | 19 | Intron 3, nt 11 to 29 |
| ABO008s | acgtgtctggtgaatgtgtg | 20 | Intron 3, nt 1184 to 1203 |
| ABO013s | cagGATGGTCTACCCCCAG | 19 | Intron 4, nt 1684 to exon 5 nt 16 |
| ABO024as | ACAATGGGAGCCAGCCAAG | 19 | Exon 6, nt 266 to 284 |
| ABO026s | gctgaatcagagactctgag | 20 | Intron 4, nt 1473 to 1492 |
| ABO032s | CAGTTCAGGCTCCAGAACAC | 20 | Exon 6, nt 322 to 341 |
| ABO035as* | acctcaatgtccacagtcac | 20 | Intron 6, nt 46 to 65 |
| ABO037s | tcactgaccagagatagcag | 20 | Intron 6, nt 332 to 351 |
| ABO039s* | cgtccgcctgccttgcag | 18 | Intron 6, nt 1035 to 1052 |
| ABO042as | GGTGGCCCACCATGAAGTG | 19 | Exon 7, nt 418 to 436 |
| ABO105as* | tcccagagcccctggcag | 18 | 3′-UTR, nt 5 to 22 |
| ABO138s | CGCACTTCGACCTATGATCC | 20 | Exon 2, nt 45 to 64 |
| ABO139as | CAGGCTTCCTGGCATTAGAC | 20 | Exon 3, nt 122 to 141 |
| ABO140as | ctgtgttctcattctgcagC | 20 | Intron 3, nt 1433 to exon 4, nt 156 |
| ABO141s | AAGCCCCAGAAGTCTAATGC | 20 | Exon 3, nt 111 to 130 |
| ABO142as | gggaggcactgacattatac | 20 | Intron 4, nt 1 to 20 |
| ABO143s | ggacgggcctcctgcag | 17 | Intron 6, nt 983 to 999 |
| ABO145s | ctacactgggttcccaaatc | 20 | Intron 3, nt 306 to 325 |
| ABO147s | aagtgattctcctgcctcag | 20 | Intron 4, nt 330 to 349 |
| ABO149as | cccctcccatcaagagatg | 19 | Intron 3, nt 1110 to 1138 |
| ABO165as | aaccgccctctaataccttc | 20 | Intron 5, nt 52 to 71 |
| ABO186as | cagctactcaggaggctgc | 19 | Intron 4, nt 324 to 342 |
| ABO214as | GGTAGACCATCctgcaagcg | 20 | Intron 4, nt 1678 to exon 5, nt 11 |
| ABO217s* | ggcgccgtcccttcctag | 18 | 5′-UTR, nt 1866 to 1883 |
| ABO219s | ccccagctcaccattccatg | 20 | Intron 4, nt 851 to 870 |
| ABO274as* | cctgcggtagcggctccct | 19 | Intron 1, nt 33 to 51 |
| ABO296s* | ggaaacaaatcctacccctac | 21 | 5′-UTR, nt -3988 to -3968 |
| ABO297as* | gtgctgcctgtgcctgttac | 20 | 5′-UTR, nt -3664 to -3645 |
Primer sequences corresponding to noncoding sequences are shown in lowercase. Nucleotide (nt) positions refer to the mRNA sequence for primers located in the coding region. Primers in the noncoding regions are numbered starting from the beginning of each intron or untranslated region (UTR). The locations of the ABO296s and ABO297as primers used to amplify the Enhancer (CBF/NF-Y) are indicated relative to the transcription start site.
s indicates sense primer; as, antisense primer; nt, nucleotide.
Previously published primers.6,10,14