Table 1.

Amplification primers


Name

Sequence (5′→3′)

Length, bp

Location
ABO003s   gatctggactgggtttggag   20   Intron 1, nt 12797 to 12816  
ABO007as   atgcagcagaagtgatgctg   20   Intron 3, nt 1059 to 1078  
ABO012as   ggtcaaaactgaagctccag   20   Intron 4, nt 194 to 213  
ABO017as   tgggcctctgaattcagatg   20   Intron 5, nt 129 to 148  
ABO020s*  gcacgcctctctccatgtg   19   Intron 5, nt 532 to 551  
ABO021s*  GGAAGGATGTCCTCGTGGTA   20   Exon 6, nt 242 to 261  
ABO023s*  GGAAGGATGTCCTCGAGGTG   20   Exon 6, nt 242 to 261  
ABO024as   ACAATGGGAGCCAGCCAAG   19   Exon 6, nt 266 to 284  
ABO026s   gctgaatcagagactctgag   20   Intron 4, nt 1473 to 1492  
ABO028s*  CATTGTCTGGGAGGGCACA   19   Exon 6, nt 279 to 297  
ABO080as*  AGAAATCGCCCTCGTGCTTA   20   Exon 7, nt 771 to 790  
ABO090as*  CCGACCCCCCGAAGAACC   18   Exon 7, nt 803 to 820  
ABO118as   cctaggcttcagttactcac   20   3′-UTR, nt 103 to 122  
ABO127as   GACTTCTGGGGCTTAGGAC   19   Exon 3, nt 106 to 124  
ABO128as   AGACTTCTGGGGCTTAGGAA   20   Exon 3, nt 106 to 125  
ABO129s   gagctttgctgagaacttgc   20   Intron 2, nt 564 to 583  
ABO130s   AACCTGACCATCTGCAGCG   19   Exon 4, nt 170 to 188  
ABO131s   GAACCTGACCATCTGGAGCA   20   Exon 4, nt 169 to 188  
ABO137s   gcacttgtgccctaaatcct   20   Intron 3, nt 1390 to 1409  
ABO164s   tcctttctgcagTTACGGGT   20   Intron 2, nt 713 to exon 3 nt 106  
ABO184s   cttagtccctcttgccagttta   22   Intron 4, nt 1446 to 1467  
ABO205s   accctcctgcccacgtcca   19   Intron 2, nt 521 to 539  
ABO212s   cagggtcctaaggacagttaa   21   Intron 2, nt 107 to 127  
ABO214as   ggtagaccatcctgctagcg   20   Intron 4, nt 1678 to 1697  
ABO217s*  ggcgccgtcccttcctag   18   5′-UTR, nt -188 to -171  
ABO269s   tcacgtggcggcgctttgc   19   Intron 4, nt 1660 to 1678  
ABO270as   GGGAGCCAGCCAAGGGGTA   19   Exon 6, nt 261 to 279  
ABO274as*  cctgcggtagcggctccct   19   Intron 1, nt 33 to 51  
ABO296s*  ggaaacaaatcctacccctac   21   5′-UTR, nt -3988 to -3968  
ABO297as*
 
gtgctgcctgtgcctgttac
 
20
 
5′-UTR, nt -3664 to -3645
 

Name

Sequence (5′→3′)

Length, bp

Location
ABO003s   gatctggactgggtttggag   20   Intron 1, nt 12797 to 12816  
ABO007as   atgcagcagaagtgatgctg   20   Intron 3, nt 1059 to 1078  
ABO012as   ggtcaaaactgaagctccag   20   Intron 4, nt 194 to 213  
ABO017as   tgggcctctgaattcagatg   20   Intron 5, nt 129 to 148  
ABO020s*  gcacgcctctctccatgtg   19   Intron 5, nt 532 to 551  
ABO021s*  GGAAGGATGTCCTCGTGGTA   20   Exon 6, nt 242 to 261  
ABO023s*  GGAAGGATGTCCTCGAGGTG   20   Exon 6, nt 242 to 261  
ABO024as   ACAATGGGAGCCAGCCAAG   19   Exon 6, nt 266 to 284  
ABO026s   gctgaatcagagactctgag   20   Intron 4, nt 1473 to 1492  
ABO028s*  CATTGTCTGGGAGGGCACA   19   Exon 6, nt 279 to 297  
ABO080as*  AGAAATCGCCCTCGTGCTTA   20   Exon 7, nt 771 to 790  
ABO090as*  CCGACCCCCCGAAGAACC   18   Exon 7, nt 803 to 820  
ABO118as   cctaggcttcagttactcac   20   3′-UTR, nt 103 to 122  
ABO127as   GACTTCTGGGGCTTAGGAC   19   Exon 3, nt 106 to 124  
ABO128as   AGACTTCTGGGGCTTAGGAA   20   Exon 3, nt 106 to 125  
ABO129s   gagctttgctgagaacttgc   20   Intron 2, nt 564 to 583  
ABO130s   AACCTGACCATCTGCAGCG   19   Exon 4, nt 170 to 188  
ABO131s   GAACCTGACCATCTGGAGCA   20   Exon 4, nt 169 to 188  
ABO137s   gcacttgtgccctaaatcct   20   Intron 3, nt 1390 to 1409  
ABO164s   tcctttctgcagTTACGGGT   20   Intron 2, nt 713 to exon 3 nt 106  
ABO184s   cttagtccctcttgccagttta   22   Intron 4, nt 1446 to 1467  
ABO205s   accctcctgcccacgtcca   19   Intron 2, nt 521 to 539  
ABO212s   cagggtcctaaggacagttaa   21   Intron 2, nt 107 to 127  
ABO214as   ggtagaccatcctgctagcg   20   Intron 4, nt 1678 to 1697  
ABO217s*  ggcgccgtcccttcctag   18   5′-UTR, nt -188 to -171  
ABO269s   tcacgtggcggcgctttgc   19   Intron 4, nt 1660 to 1678  
ABO270as   GGGAGCCAGCCAAGGGGTA   19   Exon 6, nt 261 to 279  
ABO274as*  cctgcggtagcggctccct   19   Intron 1, nt 33 to 51  
ABO296s*  ggaaacaaatcctacccctac   21   5′-UTR, nt -3988 to -3968  
ABO297as*
 
gtgctgcctgtgcctgttac
 
20
 
5′-UTR, nt -3664 to -3645
 

Primer sequences corresponding to noncoding sequences are shown in lowercase. Bold letters indicate artificial mismatches to increase PCR specificity. Nucleotide (nt) positions refer to the mRNA sequence for primers located in the coding region. Primers in the noncoding regions are numbered starting from the beginning of each intron or untranslated region (UTR). The locations of the ABO296s and ABO297as primers used to amplify the Enhancer (CBF/NF-Y) are indicated relative to the transcription start site. s indicates sense primer; as, antisense primer; and nt, nucleotide.

*

Previously published primers.6,10,14