Table 1.

TCR and IgH gene rearrangements in case 1




Development of Burkitt lymphoma, Feb 1996

Burkitt lymphoma remission after chemotherapy, Dec 1998

Development of LyP, Aug 2000

Development of ALCL, Dec 2000
IgH-VDJ rearrangement in bone marrow*  Present*  Absent*  Absent*  ND  
TCR-γ gene rearrangement     
Bone marrow   Biallelic (V2/4-J1/2 and V9-J1/2)*  Biallelic (V2/4-J1/2 and V9-J1/2)*  Biallelic (V2/4-J1/2 and V9-J1/2)*  ND  
Peripheral blood   ND   ND   Biallelic (V2/4-J1/2 and V9-J1/2)*  ND  
Skin lesions
 
NA
 
NA
 
Biallelic (V2/4-J1/2 and V9-J1/2§ (lesions of LyP)
 
Biallelic (V2/4-J1/2 and V9-J1/2§ (lesions of ALCL)
 



Development of Burkitt lymphoma, Feb 1996

Burkitt lymphoma remission after chemotherapy, Dec 1998

Development of LyP, Aug 2000

Development of ALCL, Dec 2000
IgH-VDJ rearrangement in bone marrow*  Present*  Absent*  Absent*  ND  
TCR-γ gene rearrangement     
Bone marrow   Biallelic (V2/4-J1/2 and V9-J1/2)*  Biallelic (V2/4-J1/2 and V9-J1/2)*  Biallelic (V2/4-J1/2 and V9-J1/2)*  ND  
Peripheral blood   ND   ND   Biallelic (V2/4-J1/2 and V9-J1/2)*  ND  
Skin lesions
 
NA
 
NA
 
Biallelic (V2/4-J1/2 and V9-J1/2§ (lesions of LyP)
 
Biallelic (V2/4-J1/2 and V9-J1/2§ (lesions of ALCL)
 

ND indicates not done; NA, not applicable.

*

Determined by manual sequence analysis and MRD analysis.

The frequency of bone marrow clone was approximately 8% in comparison with peripheral blood in year 2000.

Sequences for the first allele. V segment: ATTACTGTGCCACCTGGGATG; N-region: CCCCCTTTCCG; J segment: AGAAACTCTTTGG.

§

Sequences for the second allele: V segment: TACTACTGTGCCTTGTGGGAGG; N-region: TGCTTTAGCCACTGG; J-segment: TTATAAGAAACTCTTTGG.

Determined by PCR and capillary electrophoresis. The sequences were identical with those obtained by manual sequencing of fresh tissue in the samples of the bone marrow, blood, LyP lesions (n = 2) and ALCL lesions (n = 1).

or Create an Account

Close Modal
Close Modal