Table 2. FV gene amplification and... | American Society of Hematology

Table 2.

FV gene amplification and sequencing primers

	Primer	Sequence (5′-3′)	Position	PCR product (bp)	Annealing (°C)
Promoter	HCVP-F	CTATGCTGCAGCTTAGCTGG	−684 to −665^*	597	58
	HCVP-R	GCTGCAATGAGCTCTAGAGG	−88 to −107^*
Exon 1	HCFV-1F	AGGACGCTGCCACCCACAG	−126 to −108^*	309	64
	HCFV-1R	CACCCGGACTCCACACCTG	intron 1, nt +25 to +7
Exon 2	HCFV-2F	GTGAACAAATAGTTATCACAACAGG	intron 1, nt −223 to −199	383	59
	HCFV-2R	TGCATGTGAATGCCAAATTACC	intron 2, nt +68 to +47
Exon 3	HCFV-3F	GATGACCCTGAATACAGACATAG	intron 2, nt −44 to −22	228	59
	HCFV-3R	GATGCTGGTATTAAAGACTTAGAC	intron 3, nt +61 to +38
Exon 4	HCFV-4F	ACTGCCCACATGTCTTGATGG	intron 3, nt −36 to −16	311	58
	HCFV-4R	TGACAGAACTCCTGACCATTCC	intron 4, nt +62 to +41
Exon 5	HCFV-5F	CTGCAGTGCTACTGAAAACATG	intron 4, nt −37 to −16	306	58
	HCFV-5R	TCCTTCTTGATAGGGAGTTGC	intron 5, nt +125 to +105
Exon 6	HCFV-6F	GCCTAATCCTTTAGCAATCCCTG	intron 5, nt −290 to −268	547	58
	HCFV-6R	CATTGAGAAGCAAGACTGTCAGG	intron 6, nt +35 to +13
Exon 7	HCFV-7F	GAGTTATTTCATTGTCTTTCTGTCC	intron 6, nt −33 to −9	241	58
	HCFV-7R	GTCTTGAACCTTTGCCCAG	intron 7, nt +42 to +24
Exon 8	HCFV-8F	GCAGAATGTTTAAGCACAAGG	intron 7, nt −87 to −67	306	56
	HCFV-8R	CTATGTAATTTCTCCCATGATTCTG	intron 8, nt +41 to +17
Exon 9	HCFV-9F	GATGACTTCAAAGACAGTGTCC	intron 8, nt −422 to −401	550	56
	HCFV-9R	GGATTCAGTAGAAGTGAAAGATTC	intron 9, nt +28 to +5
Exon 10	HCFV-10F	ATGACAAGTTAATGGGTGCAGC	intron 9, nt −227 to −206	541	58
	FV-10R	CTTGAAGGAAATGCCCCATTA^†	intron 10, nts +99 to +79
Exon 11	HCFV-11F	TGGTCTATGCGTCTGTTCTTGTAC	intron 10, nt −50 to −27	250	62
	HCFV-11R	CAACCACAGGAATGAAAAACTG	intron 11, nt +49 to +28
Exon 12	HCFV-12F	CATAGACTTGGAATTTTAACAG	intron 11, nt −37 to −16	286	50
	HCFV-12R	CAAGCTTCCTCTGTGAGTGTC	intron 12, nt +36 to +16
Exon 13a	HCFV-13aF	TCCCAGACTTCCAGATCTCTC	intron 12, nt −44 to −24	605	60
	HCFV-13aR	CTGTGACATCTGGCTGTAGAGG	exon 13, nt 2626 to 2605
Exon 13b	HCFV-13bF	CCAGCCCATATTCTGAAGACC	exon 13, nt 2573 to 2593	608	60
	HCFV-13bR	TCGTGTCTTAATGAGAAACTGGC	exon 13, nt 3180 to 3158
Exon 13c	HCFV-13cF	TCTACAAGTAAGACAGGATGGAGG	exon 13, nt 3114 to 3137	626	60
	HCFV-13cR	GTTCTGGAGAGAGAGTCGTGTG	exon 13, nt 3739 to 3718
Exon 13d	HCFV-L13F1	CAAGTCCTTCCCCACAGATATA^‡	exon 13, nt 3579 to 3600	1002	59
	HCFV-L13R2	GTAGGAGATGAAGGAGATGG^‡	exon 13, nt 4580 to 4561
	HCFV-L13F2	ATGCCCCTCTTTGCAGATCT^‡,^2-153	exon 13, nt 4261 to 4280
	HCFV-L13R1	AGATCTGCAAAGAGGGGCAT^‡,^2-153	exon 13, nt 4280 to 4261
Exon 13e	HCFV-13eF	CTTCTGAATCTAGTCAGTCATTGC	exon 13, nt 4487 to 4510	450	60
	HCFV-13eR	TTCAGCAGTAATGGAAAAATGAG	intron 13, nt +50 to +28
Exon 14	HCFV-14F	CTGACCTCATGGCACTTATACC	intron 13, nt −408 to −387	615	56
	HCFV-14R	CCGAAGATCTTAGCAGTGCTC	intron 14, nt +32 to +12
Exon 15	HCFV-15F2	GGCCATATCTCACAGGATGG	intron 14, nt −177 to −158	600	56
	HCFV-15R	GTCATCTGAAGAGCTGCATGG	intron 15, nt +186 to +166
Exon 16	HCFV-16F	AGTGCATGGTAAGCACTTGG	intron 15, nt −381 to −362	761	55
	HCFV-16R2	ACCTGCCAGATTACATCAGC	intron 16, nt +169 to +150
Exon 17	HCFV-17F2	CCTTTCCATGGCTAGGTAGG	intron 16, nt −139 to −120	356	55
	HCFV-17R	TCTTAGCAGGGACCTCTTCC	intron 17, nt +37 to +18
Exon 18	HCFV-18F	GAAAGCCTCTTGTGAAGCAGG	intron 17, nt −104 to −84	388	58
	HCFV-18R2	TTCAATGCAATCAGACCATGG	intron 18, nt +167 to +147
Exon 19	HCFV-19F	ATTGAGTCAGAAACATAATCCC	intron 18, nt −95 to −74	222	58
	HCFV-19R	GCATGCTGCACAACTGTAGG	intron 19, nt +55 to +36
Exon 20	HCFV-20F	AAGGATCTGGTTTTCCACTGG	intron 19, nt −93 to −73	366	57
	HCFV-20R2	ACCTCAGAGGGTTGATTTTAAGG	intron 20, nt +169 to +147
Exon 21	HCFV-21F	GCAGTGTGTGACTTGTTGAC	intron 20, nt −57 to −38	241	58
	HCFV-21R	AGATTCAGATAGAAATATGCACAC	intron 21, nt +28 to +5
Exon 22	HCFV-22F	TCTTCCTGGAACTGGAATTATCC	intron 21, nt −165 to −143	360	57
	HCFV-22R	TCTTGATTCTTTGAGTGGCAGTG	intron 22, nt +50 to +28
Exon 23	HCFV-23F2	TGAGAACAGTATTTGGCACTTGG	intron 22, nt −162 to −140	398	58
	HCFV-23R	CCAGATCCTCCATGTTTGTGG	intron 23, nt +84 to +64
Exon 24	HCFV-24F	AAGCAAAGGTTTTAACATCTTCC	intron 23, nt −52 to −30	258	56
	HCFV-24R	TCTTTGCCCAGATGCCAC	intron 24, nt +23 to +6
Exon 25	HCFV-25F	CAGTCATACAGCTAATACAGACG	intron 24, nt −441 to −419	630	58
	HCFV-25R	GGTCTTAAAGAGTCTCTTCCAGG	exon 25, nt +42 to +20^2-154

	Primer	Sequence (5′-3′)	Position	PCR product (bp)	Annealing (°C)
Promoter	HCVP-F	CTATGCTGCAGCTTAGCTGG	−684 to −665^*	597	58
	HCVP-R	GCTGCAATGAGCTCTAGAGG	−88 to −107^*
Exon 1	HCFV-1F	AGGACGCTGCCACCCACAG	−126 to −108^*	309	64
	HCFV-1R	CACCCGGACTCCACACCTG	intron 1, nt +25 to +7
Exon 2	HCFV-2F	GTGAACAAATAGTTATCACAACAGG	intron 1, nt −223 to −199	383	59
	HCFV-2R	TGCATGTGAATGCCAAATTACC	intron 2, nt +68 to +47
Exon 3	HCFV-3F	GATGACCCTGAATACAGACATAG	intron 2, nt −44 to −22	228	59
	HCFV-3R	GATGCTGGTATTAAAGACTTAGAC	intron 3, nt +61 to +38
Exon 4	HCFV-4F	ACTGCCCACATGTCTTGATGG	intron 3, nt −36 to −16	311	58
	HCFV-4R	TGACAGAACTCCTGACCATTCC	intron 4, nt +62 to +41
Exon 5	HCFV-5F	CTGCAGTGCTACTGAAAACATG	intron 4, nt −37 to −16	306	58
	HCFV-5R	TCCTTCTTGATAGGGAGTTGC	intron 5, nt +125 to +105
Exon 6	HCFV-6F	GCCTAATCCTTTAGCAATCCCTG	intron 5, nt −290 to −268	547	58
	HCFV-6R	CATTGAGAAGCAAGACTGTCAGG	intron 6, nt +35 to +13
Exon 7	HCFV-7F	GAGTTATTTCATTGTCTTTCTGTCC	intron 6, nt −33 to −9	241	58
	HCFV-7R	GTCTTGAACCTTTGCCCAG	intron 7, nt +42 to +24
Exon 8	HCFV-8F	GCAGAATGTTTAAGCACAAGG	intron 7, nt −87 to −67	306	56
	HCFV-8R	CTATGTAATTTCTCCCATGATTCTG	intron 8, nt +41 to +17
Exon 9	HCFV-9F	GATGACTTCAAAGACAGTGTCC	intron 8, nt −422 to −401	550	56
	HCFV-9R	GGATTCAGTAGAAGTGAAAGATTC	intron 9, nt +28 to +5
Exon 10	HCFV-10F	ATGACAAGTTAATGGGTGCAGC	intron 9, nt −227 to −206	541	58
	FV-10R	CTTGAAGGAAATGCCCCATTA^†	intron 10, nts +99 to +79
Exon 11	HCFV-11F	TGGTCTATGCGTCTGTTCTTGTAC	intron 10, nt −50 to −27	250	62
	HCFV-11R	CAACCACAGGAATGAAAAACTG	intron 11, nt +49 to +28
Exon 12	HCFV-12F	CATAGACTTGGAATTTTAACAG	intron 11, nt −37 to −16	286	50
	HCFV-12R	CAAGCTTCCTCTGTGAGTGTC	intron 12, nt +36 to +16
Exon 13a	HCFV-13aF	TCCCAGACTTCCAGATCTCTC	intron 12, nt −44 to −24	605	60
	HCFV-13aR	CTGTGACATCTGGCTGTAGAGG	exon 13, nt 2626 to 2605
Exon 13b	HCFV-13bF	CCAGCCCATATTCTGAAGACC	exon 13, nt 2573 to 2593	608	60
	HCFV-13bR	TCGTGTCTTAATGAGAAACTGGC	exon 13, nt 3180 to 3158
Exon 13c	HCFV-13cF	TCTACAAGTAAGACAGGATGGAGG	exon 13, nt 3114 to 3137	626	60
	HCFV-13cR	GTTCTGGAGAGAGAGTCGTGTG	exon 13, nt 3739 to 3718
Exon 13d	HCFV-L13F1	CAAGTCCTTCCCCACAGATATA^‡	exon 13, nt 3579 to 3600	1002	59
	HCFV-L13R2	GTAGGAGATGAAGGAGATGG^‡	exon 13, nt 4580 to 4561
	HCFV-L13F2	ATGCCCCTCTTTGCAGATCT^‡,^2-153	exon 13, nt 4261 to 4280
	HCFV-L13R1	AGATCTGCAAAGAGGGGCAT^‡,^2-153	exon 13, nt 4280 to 4261
Exon 13e	HCFV-13eF	CTTCTGAATCTAGTCAGTCATTGC	exon 13, nt 4487 to 4510	450	60
	HCFV-13eR	TTCAGCAGTAATGGAAAAATGAG	intron 13, nt +50 to +28
Exon 14	HCFV-14F	CTGACCTCATGGCACTTATACC	intron 13, nt −408 to −387	615	56
	HCFV-14R	CCGAAGATCTTAGCAGTGCTC	intron 14, nt +32 to +12
Exon 15	HCFV-15F2	GGCCATATCTCACAGGATGG	intron 14, nt −177 to −158	600	56
	HCFV-15R	GTCATCTGAAGAGCTGCATGG	intron 15, nt +186 to +166
Exon 16	HCFV-16F	AGTGCATGGTAAGCACTTGG	intron 15, nt −381 to −362	761	55
	HCFV-16R2	ACCTGCCAGATTACATCAGC	intron 16, nt +169 to +150
Exon 17	HCFV-17F2	CCTTTCCATGGCTAGGTAGG	intron 16, nt −139 to −120	356	55
	HCFV-17R	TCTTAGCAGGGACCTCTTCC	intron 17, nt +37 to +18
Exon 18	HCFV-18F	GAAAGCCTCTTGTGAAGCAGG	intron 17, nt −104 to −84	388	58
	HCFV-18R2	TTCAATGCAATCAGACCATGG	intron 18, nt +167 to +147
Exon 19	HCFV-19F	ATTGAGTCAGAAACATAATCCC	intron 18, nt −95 to −74	222	58
	HCFV-19R	GCATGCTGCACAACTGTAGG	intron 19, nt +55 to +36
Exon 20	HCFV-20F	AAGGATCTGGTTTTCCACTGG	intron 19, nt −93 to −73	366	57
	HCFV-20R2	ACCTCAGAGGGTTGATTTTAAGG	intron 20, nt +169 to +147
Exon 21	HCFV-21F	GCAGTGTGTGACTTGTTGAC	intron 20, nt −57 to −38	241	58
	HCFV-21R	AGATTCAGATAGAAATATGCACAC	intron 21, nt +28 to +5
Exon 22	HCFV-22F	TCTTCCTGGAACTGGAATTATCC	intron 21, nt −165 to −143	360	57
	HCFV-22R	TCTTGATTCTTTGAGTGGCAGTG	intron 22, nt +50 to +28
Exon 23	HCFV-23F2	TGAGAACAGTATTTGGCACTTGG	intron 22, nt −162 to −140	398	58
	HCFV-23R	CCAGATCCTCCATGTTTGTGG	intron 23, nt +84 to +64
Exon 24	HCFV-24F	AAGCAAAGGTTTTAACATCTTCC	intron 23, nt −52 to −30	258	56
	HCFV-24R	TCTTTGCCCAGATGCCAC	intron 24, nt +23 to +6
Exon 25	HCFV-25F	CAGTCATACAGCTAATACAGACG	intron 24, nt −441 to −419	630	58
	HCFV-25R	GGTCTTAAAGAGTCTCTTCCAGG	exon 25, nt +42 to +20^2-154

Relative to the start codon (reference 14).

†

From reference 63.

‡

From reference 60.

F2-153

Additional primers used for DNA sequence analysis of exon 13d.

F2-154

Relative to the termination codon (reference 14).

View Large

This Feature Is Available To Subscribers Only