Table 1. Probes and primers for cytokine... | American Society of Hematology

Table 1.

Probes and primers for cytokine receptors

Probe	Size (b)	Source	Offset^*	Primers^†	Reference^‡	Donor
IL-1RI	545	PCR	37	5′-ggagagcagtgacagagaa+	81
				5′tgatcaataatatgcactgt−
IL-1RII	763	3′-EcoRI-XbaI	0		82	U. Gubler
IL-2Rβ^1-153	1700	3′ fragment of mIL2Rb-12	660		83	T. Taniguchi
	235	PCR	47	5′ tttatgtgttcttgggcgat+
				5′ acttttcccagatgttgcat−
IL-3Rβ	980	3′BamHI of A1C2A-32	0		84	A. Miyajima
IL-4Rα	1300	3′ XhoI of pEV40-mIL4R	200		85	A. Miyajima
IL-6Rα	990	3′EcoRI of pMR301I	0		86	T. Kishimoto
gp130	1100	3′ EcoRI of pBSSkm130	0		70	T. Kishimoto
IL-7Rα^1-153	269	PCR	270/665	5′ ggcataccatgaccatgtgt+	87	C. Paige
				5′ cacacataggaggactcaca−
Upstream	317	PCR	19	5′ gccaatctacaggagttcaa+
				5′ cacccaaccacagtatcttt−
Downstream	249		0	5′ ctgccaattttcctcttggt+
				5′ ccagaaaatagcgcatgctt−
IL-11Rα	332	PCR	56	5′ cttctcttgccttggcctgg+	88
				5′ gaccgcacacactctccaat−
c-fms	427	3′ApaLI-EcoRI	0		22	L. Rohrschneider
	217	Progenitor cell PCR clone	0		Iscove, unpublished
c-kit^1-153 A	315	PCR (blot)	25	5′ gtcttggatattcttgaaag+	4
				oligo(dT)−
B	248	PCR (secondary)	12	5′ tacatcagatgtcagatgtt+	89
				5′ tagaattcttcagaactgtc−
EpoR	465	3′BanI-XhoI of pER190-133	0		90	A. D'Andrea
flk-1^1-155	247	PCR	13	5′ ttctctgtcaagtggcggta+	91
				5′ aggcagaaaccagtagacat−
flk-2	265		76	5′ aagattagcctcgcctctga+	92
				5′ cccttagcaaaaaacgggtt
G-CSFR^1-154	260	PCR	200	5′ cttctcaggctataccctga+	93
				5′ tggatctcactatgtaggct−
GM-CSFRα	346	pBSmGMRa71	21		59	L. S. Park
TNFR-I	860	3′BamHI-EcoRI	248		94	T. Mak

Probe	Size (b)	Source	Offset^*	Primers^†	Reference^‡	Donor
IL-1RI	545	PCR	37	5′-ggagagcagtgacagagaa+	81
				5′tgatcaataatatgcactgt−
IL-1RII	763	3′-EcoRI-XbaI	0		82	U. Gubler
IL-2Rβ^1-153	1700	3′ fragment of mIL2Rb-12	660		83	T. Taniguchi
	235	PCR	47	5′ tttatgtgttcttgggcgat+
				5′ acttttcccagatgttgcat−
IL-3Rβ	980	3′BamHI of A1C2A-32	0		84	A. Miyajima
IL-4Rα	1300	3′ XhoI of pEV40-mIL4R	200		85	A. Miyajima
IL-6Rα	990	3′EcoRI of pMR301I	0		86	T. Kishimoto
gp130	1100	3′ EcoRI of pBSSkm130	0		70	T. Kishimoto
IL-7Rα^1-153	269	PCR	270/665	5′ ggcataccatgaccatgtgt+	87	C. Paige
				5′ cacacataggaggactcaca−
Upstream	317	PCR	19	5′ gccaatctacaggagttcaa+
				5′ cacccaaccacagtatcttt−
Downstream	249		0	5′ ctgccaattttcctcttggt+
				5′ ccagaaaatagcgcatgctt−
IL-11Rα	332	PCR	56	5′ cttctcttgccttggcctgg+	88
				5′ gaccgcacacactctccaat−
c-fms	427	3′ApaLI-EcoRI	0		22	L. Rohrschneider
	217	Progenitor cell PCR clone	0		Iscove, unpublished
c-kit^1-153 A	315	PCR (blot)	25	5′ gtcttggatattcttgaaag+	4
				oligo(dT)−
B	248	PCR (secondary)	12	5′ tacatcagatgtcagatgtt+	89
				5′ tagaattcttcagaactgtc−
EpoR	465	3′BanI-XhoI of pER190-133	0		90	A. D'Andrea
flk-1^1-155	247	PCR	13	5′ ttctctgtcaagtggcggta+	91
				5′ aggcagaaaccagtagacat−
flk-2	265		76	5′ aagattagcctcgcctctga+	92
				5′ cccttagcaaaaaacgggtt
G-CSFR^1-154	260	PCR	200	5′ cttctcaggctataccctga+	93
				5′ tggatctcactatgtaggct−
GM-CSFRα	346	pBSmGMRa71	21		59	L. S. Park
TNFR-I	860	3′BamHI-EcoRI	248		94	T. Mak

Offset (b) of 3′ end of probe from polyA tail.

Primers: (+) upstream, sense; (−) downstream, antisense.

Defining report.

Sequence extended to 3′ terminus by ESTs, as annotated in NCBI RefSeqs: c-kit-RefSeq NM_021099; IL-2Rβ-RefSeq NM_008368; IL-7Rα-RefSeq NM_008372.

Atypical polyadenylation signal ATAAAA, 3′ terminus confirmed by ESTs.

G-CSFR probe excludes a 3′ terminal motif spanning nucleotides 3114 to 3245 (GenBank accession #M58288.1) common to numerous GenBank entries.