Pts: patients; patients 1 and 2 had a pro-B ALL; patient 3, a common ALL; patients 4 and 5, a T-lineage ALL. They were screened for the presence of preleukemic/leukemic cells in their neonatal blood spots by the use of ASO-PCR. The sequences are subdivided into V (variable), D (diversity), and J (joining) regions. N are the candidate nucleotides for template-independent insertion, D are the residual nucleotides of the D regions, and J the 5′ end of the J regions. The V(D)J combinations are shown. Underlined sequences indicate the position of the leukemia clone-specific primers. In patient 1, the primer was placed into the VD junction (gccagaggagggtagtattacg).