Nucleotide Sequences and Positions of Primers
| Primer . | . | Sequence . | Annealing Time and Temperature . | Amplicon . | Specificity . |
|---|---|---|---|---|---|
| R-15 | Sense | 5′tatctagagacggacacaggATGAGC3′ | 1 min, 60°C | Exon 1 | Consensus |
| R31 | Sense | 5′CGCTGCCTGCCCCTCTGC3′ | Exon 1, C specific | C specific: nt 48 | |
| R147 | Antisense | 5′TTGATAGGATGCCACGAGCCCC3′ | Consensus | ||
| R496 | Sense | 5′CACATGAACATGATGCACA3′ | 1 min, 55°C | Exon 4 to 5 | D specific: nt 514 |
| Rex5AD2 | Antisense | 5′cacCTTGCTGATCTTACC3′ | Dspecific: nt 787 | ||
| R581 | Sense | 5′ACGGAGGATAAAGATCAGAG3′ | 1 min, 55°C | Intron 4, CE specific | CE specific: nt 602 |
| R667 | Antisense | 5′CTCAGCAGAGCAGAGTTGAC3′ | CE specific: nt 667 | ||
| Rex5S2 | Sense | 5′cctctctggccccaggCGCC3′ | 1 min, 55°C | Exon 5 | Consensus |
| Rex5A | Antisense | 5′cagcgccctgctcac3′ | Consensus | ||
| R678 | Sense | 5′CTGCTGAGAAGTCCAATCC3′ | 1 min, 55°C | Exon 5, CE-D hybrid | CEspecific: nt 707 |
| Rex5AD2 | Antisense | 5′cacCTTGCTGATCTTACC3′ | D specific: nt 787 | ||
| R678 | Sense | 5′CTGCTGAGAAGTCCAATCC3′ | 1 min, 55°C | Exon 5 to 6, CE-D hybrid | CE specific: nt 707 |
| R933 | Antisense | 5′GTACTTGGCTCCCCCGAC3′ | Dspecific: nt 916 | ||
| R716 | Sense | 5′TCAACACCTACTATGCTG3′ | 1 min, 55°C | Intron 5 | VS and D specific: nt 733 |
| R870 | Antisense | 5′AGAAGGGATCAGGTGACACG3′ | Consensus | ||
| Rex6S | Sense | 5′gctatttctttgcag3′ | 30 s, 48°C | Exon 6 | Consensus |
| Rex6A | Antisense | 5′tgtctagtttcttca3′ | α taq added | Consensus | |
| R973 | Sense | 5′AGCTCCATCATGGGCTACAA3′ | 1 min, 67°C | Exon 6 to 7,D-CE hybrid | D specific: nt 992 |
| R1044 | Antisense | 5′CACCAGCAGCACAATGTAGG3′ | CEspecific: nt 1025 | ||
| R973 | Sense | 5′AGCTCCATCATGGGCTACAA3′ | 1 min, 55°C | Exon 7 | D specific: nt 992 |
| R1068 | Antisense | 5′ATTGCCGGCTCCGACGGTATC3′ | Dspecific: nt 1068 | ||
| R-15 | Sense | 5′tatctagagacggacacaggATGAGC3′ | 1.5 min, 55°C | Full-length cDNA | Consensus |
| R1339 | Antisense | 5′gcgtttctcacgtacaaatgc3′ | Consensus |
| Primer . | . | Sequence . | Annealing Time and Temperature . | Amplicon . | Specificity . |
|---|---|---|---|---|---|
| R-15 | Sense | 5′tatctagagacggacacaggATGAGC3′ | 1 min, 60°C | Exon 1 | Consensus |
| R31 | Sense | 5′CGCTGCCTGCCCCTCTGC3′ | Exon 1, C specific | C specific: nt 48 | |
| R147 | Antisense | 5′TTGATAGGATGCCACGAGCCCC3′ | Consensus | ||
| R496 | Sense | 5′CACATGAACATGATGCACA3′ | 1 min, 55°C | Exon 4 to 5 | D specific: nt 514 |
| Rex5AD2 | Antisense | 5′cacCTTGCTGATCTTACC3′ | Dspecific: nt 787 | ||
| R581 | Sense | 5′ACGGAGGATAAAGATCAGAG3′ | 1 min, 55°C | Intron 4, CE specific | CE specific: nt 602 |
| R667 | Antisense | 5′CTCAGCAGAGCAGAGTTGAC3′ | CE specific: nt 667 | ||
| Rex5S2 | Sense | 5′cctctctggccccaggCGCC3′ | 1 min, 55°C | Exon 5 | Consensus |
| Rex5A | Antisense | 5′cagcgccctgctcac3′ | Consensus | ||
| R678 | Sense | 5′CTGCTGAGAAGTCCAATCC3′ | 1 min, 55°C | Exon 5, CE-D hybrid | CEspecific: nt 707 |
| Rex5AD2 | Antisense | 5′cacCTTGCTGATCTTACC3′ | D specific: nt 787 | ||
| R678 | Sense | 5′CTGCTGAGAAGTCCAATCC3′ | 1 min, 55°C | Exon 5 to 6, CE-D hybrid | CE specific: nt 707 |
| R933 | Antisense | 5′GTACTTGGCTCCCCCGAC3′ | Dspecific: nt 916 | ||
| R716 | Sense | 5′TCAACACCTACTATGCTG3′ | 1 min, 55°C | Intron 5 | VS and D specific: nt 733 |
| R870 | Antisense | 5′AGAAGGGATCAGGTGACACG3′ | Consensus | ||
| Rex6S | Sense | 5′gctatttctttgcag3′ | 30 s, 48°C | Exon 6 | Consensus |
| Rex6A | Antisense | 5′tgtctagtttcttca3′ | α taq added | Consensus | |
| R973 | Sense | 5′AGCTCCATCATGGGCTACAA3′ | 1 min, 67°C | Exon 6 to 7,D-CE hybrid | D specific: nt 992 |
| R1044 | Antisense | 5′CACCAGCAGCACAATGTAGG3′ | CEspecific: nt 1025 | ||
| R973 | Sense | 5′AGCTCCATCATGGGCTACAA3′ | 1 min, 55°C | Exon 7 | D specific: nt 992 |
| R1068 | Antisense | 5′ATTGCCGGCTCCGACGGTATC3′ | Dspecific: nt 1068 | ||
| R-15 | Sense | 5′tatctagagacggacacaggATGAGC3′ | 1.5 min, 55°C | Full-length cDNA | Consensus |
| R1339 | Antisense | 5′gcgtttctcacgtacaaatgc3′ | Consensus |
The sequences of the oligonucleotides are given in capital letters when exon sequences are indicated and in small letters when intron sequences are indicated.