Table 1.

Primers Used

Name Nucleotide Sequence Genomic Region Position*Orientation RHD-Specific
ra21 gtgccacttgacttgggact  Intron 2  2,823 to 2,842  Sense No  
rb7  atctctccaagcagacccagcaagc  Exon 7 1,022 to 998  Antisense  No  
rb11 tacctttgaattaagcacttcacag  Intron 4  161 to 185  Sense Yes  
rb12  tcctgaacctgctctgtgaagtgc  Intron 4 198 to 175  Antisense  Yes  
rb13 ctagagccaaacccacatctcctt  Promoter  −675 to −652 Sense  No  
rb15  ttattggctacttggtgcc  Intron 5 −612 to −630  Antisense  No  
rb20d tcctggctctccctctct  Intron 2  −25 to −8  Sense Yes  
rb21  aggtccctcctccagcac  Intron 3  28 to 11 Antisense  No  
rb21d  cccaggtccctcctcccagcac  Intron 3 32 to 11  Antisense  No  
rb22  gggagattttttcagccag Intron 4  82 to 64  Antisense  No  
rb24 agacctttggagcaggagtg  Intron 4  −53 to −34  Sense No  
rb25  agcagggaggatgttacag  Intron 5 −111 to −93  Sense  No  
rb26 aggggtgggtagggaatatg  Intron 6  −62 to −43  Sense No  
rb44  gcttgaaatagaagggaaatgggagg  Intron 7  ≈3,000  Antisense  No  
rb46 tggcaagaacctggaccttgacttt  Intron 3  −1,279 to −1,255 Sense  No  
rb52  ccaggttgttaagcattgctgtacc  Intron 7 ≈−3,300  Sense  Yes  
re01 atagagaggccagcacaa  Promoter  −149 to −132  Sense Yes  
re02  tgtaactatgaggagtcag  Promoter −572 to −554  Sense  Yes  
re11d agaagatgggggaatctttttcct  Intron 1  129 to 106 Antisense  No  
re12d  attagccgggcacggtggca  Intron 1 −1,188 to −1,168  Sense  Yes  
re13 actctaatttcataccaccc  Intron 1  −72 to −53  Sense No  
re23  aaaggatgcaggaggaatgtaggc  Intron 2 251 to 227  Antisense  No  
re31  tgatgaccatcctcaggt Exon 3  472 to 455  Antisense  Yes  
re617 tctcagctcactgcaacctc  Intron 6  1,998 to 2,017  Sense No  
re621  catccccctttggtggcc  Intron 6 −102 to −85  Sense  Yes  
re71 acccagcaagctgaagttgtagcc  Exon 7  1,008 to 985 Antisense  Yes  
re73  cctttttgtccctgatgacc  Intron 7 −67 to −48  Sense  No  
re74 tatccatgaggtgctgggaac  Intron 7    ≈−200  Sense No  
re75  aaggtaggggctggacag  Intron 7    ≈120  Antisense  Yes  
re82 aaaaatcctgtgctccaaac  Intron 8     ≈−45  Sense Yes  
re83  gagattaaaaatcctgtgctcca  Intron 8    ≈−50  Sense  No  
re91 caagagatcaagccaaaatcagt  Intron 9     ≈−40  Sense  No  
re93  cacccgcatgtcagactatttggc  Intron 9    ≈300  Antisense  No  
rf51 caaaaacccattcttcccg  Intron 5  −332 to −314  Sense No  
rg62  tgtattccaggcagaaggc  Intron 6 1,736 to 1,755  Sense  No  
rh5  gcacagagacggacacag 5′ UTR† −19 to −2  Sense  No  
rh7 acgtacaaatgcaggcaac  3′ UTR  1,330 to 1,313  Antisense No  
rr1  tgttggagagaggggtgatg  5′ UTR  −60 to −41 Sense  No  
rr3  cagtctgttgtttaccagatg  3′ UTR 1,512 to 1,492  Antisense  Yes  
rr4 agcttactggatgaccacca  3′ UTR  1,541 to 1,522  Antisense Yes 
Name Nucleotide Sequence Genomic Region Position*Orientation RHD-Specific
ra21 gtgccacttgacttgggact  Intron 2  2,823 to 2,842  Sense No  
rb7  atctctccaagcagacccagcaagc  Exon 7 1,022 to 998  Antisense  No  
rb11 tacctttgaattaagcacttcacag  Intron 4  161 to 185  Sense Yes  
rb12  tcctgaacctgctctgtgaagtgc  Intron 4 198 to 175  Antisense  Yes  
rb13 ctagagccaaacccacatctcctt  Promoter  −675 to −652 Sense  No  
rb15  ttattggctacttggtgcc  Intron 5 −612 to −630  Antisense  No  
rb20d tcctggctctccctctct  Intron 2  −25 to −8  Sense Yes  
rb21  aggtccctcctccagcac  Intron 3  28 to 11 Antisense  No  
rb21d  cccaggtccctcctcccagcac  Intron 3 32 to 11  Antisense  No  
rb22  gggagattttttcagccag Intron 4  82 to 64  Antisense  No  
rb24 agacctttggagcaggagtg  Intron 4  −53 to −34  Sense No  
rb25  agcagggaggatgttacag  Intron 5 −111 to −93  Sense  No  
rb26 aggggtgggtagggaatatg  Intron 6  −62 to −43  Sense No  
rb44  gcttgaaatagaagggaaatgggagg  Intron 7  ≈3,000  Antisense  No  
rb46 tggcaagaacctggaccttgacttt  Intron 3  −1,279 to −1,255 Sense  No  
rb52  ccaggttgttaagcattgctgtacc  Intron 7 ≈−3,300  Sense  Yes  
re01 atagagaggccagcacaa  Promoter  −149 to −132  Sense Yes  
re02  tgtaactatgaggagtcag  Promoter −572 to −554  Sense  Yes  
re11d agaagatgggggaatctttttcct  Intron 1  129 to 106 Antisense  No  
re12d  attagccgggcacggtggca  Intron 1 −1,188 to −1,168  Sense  Yes  
re13 actctaatttcataccaccc  Intron 1  −72 to −53  Sense No  
re23  aaaggatgcaggaggaatgtaggc  Intron 2 251 to 227  Antisense  No  
re31  tgatgaccatcctcaggt Exon 3  472 to 455  Antisense  Yes  
re617 tctcagctcactgcaacctc  Intron 6  1,998 to 2,017  Sense No  
re621  catccccctttggtggcc  Intron 6 −102 to −85  Sense  Yes  
re71 acccagcaagctgaagttgtagcc  Exon 7  1,008 to 985 Antisense  Yes  
re73  cctttttgtccctgatgacc  Intron 7 −67 to −48  Sense  No  
re74 tatccatgaggtgctgggaac  Intron 7    ≈−200  Sense No  
re75  aaggtaggggctggacag  Intron 7    ≈120  Antisense  Yes  
re82 aaaaatcctgtgctccaaac  Intron 8     ≈−45  Sense Yes  
re83  gagattaaaaatcctgtgctcca  Intron 8    ≈−50  Sense  No  
re91 caagagatcaagccaaaatcagt  Intron 9     ≈−40  Sense  No  
re93  cacccgcatgtcagactatttggc  Intron 9    ≈300  Antisense  No  
rf51 caaaaacccattcttcccg  Intron 5  −332 to −314  Sense No  
rg62  tgtattccaggcagaaggc  Intron 6 1,736 to 1,755  Sense  No  
rh5  gcacagagacggacacag 5′ UTR† −19 to −2  Sense  No  
rh7 acgtacaaatgcaggcaac  3′ UTR  1,330 to 1,313  Antisense No  
rr1  tgttggagagaggggtgatg  5′ UTR  −60 to −41 Sense  No  
rr3  cagtctgttgtttaccagatg  3′ UTR 1,512 to 1,492  Antisense  Yes  
rr4 agcttactggatgaccacca  3′ UTR  1,541 to 1,522  Antisense Yes 
*

The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons, or relative to their adjacent exon/intron boundaries for all other primers. Primers ra2160 and rh561 were reported previously.

†

5′ UTR: 5′ untranslated region of exon 1; 3′ UTR: 3′ untranslated region of exon 10.

View Large
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal