Table 3.

Clonal Evolution During Disease Progression

Patient Stage FR3A Sequence N Sequence D Sequence N Sequence J Sequence
48  Presentation GCGAGG  tagttaggatgg  TGTAGGAGTA (DLR4)  ttgtgtgtagaa GGTA (J6)  
  GCGA  aagatccccatgtggggt GTAGTAACCAGCTG (DLR4)  ttatagtata  TACTAC (J6) 
 Week 2  GGAG  —  TAGTAG (DLR4)  gttgt TACT (J6)  
  GGAG  taggttag  GTAG (DLR4) ttgggatcg  TACT (J6)  
 Relapse  GCGAG  gccccccg AGTAGTA (DLR4)  taaggggaaccgc  CTACTACTACTA (J6) 
  GCGAGA  gatcgagagagattgcc TATTGTAGTAGTACCAGCTGCTAT (DLR4)  agtg  TACTACT (J6) 
65  Presentation  ACCTGT  acctgcccaacctttctccc CTATGGTTCGGGGAGTTAT (DXP′1)  gcacgttg  ATACT (J1) 
 Relapse  ACCTGT  acctgcccaacctttctccc CTATGGTTCGGGGAGTTAT (DXP′1)  gcacgttg  ATACT (J1) 
  GCAAGA  gacgaaa  TATGATAGTAGTGG (D21/9) ggcctattggg  CTACT (J6)  
44  Presentation  GCGAGA ggg  AGGACTGGAACTA (DLR1)  cccccggga  TTCGACC (J5) 
 Relapse  GCGAGA  ggg  AGGACTGGAACTA (DLR1) cccccggga  TTCGACC (J5)  
  ACCAAGA tcgagaaggagaagacccca  TATAGCAGCTCGT (DN4/M4) –  ACTACTTTGACTA (J4) 
Patient Stage FR3A Sequence N Sequence D Sequence N Sequence J Sequence
48  Presentation GCGAGG  tagttaggatgg  TGTAGGAGTA (DLR4)  ttgtgtgtagaa GGTA (J6)  
  GCGA  aagatccccatgtggggt GTAGTAACCAGCTG (DLR4)  ttatagtata  TACTAC (J6) 
 Week 2  GGAG  —  TAGTAG (DLR4)  gttgt TACT (J6)  
  GGAG  taggttag  GTAG (DLR4) ttgggatcg  TACT (J6)  
 Relapse  GCGAG  gccccccg AGTAGTA (DLR4)  taaggggaaccgc  CTACTACTACTA (J6) 
  GCGAGA  gatcgagagagattgcc TATTGTAGTAGTACCAGCTGCTAT (DLR4)  agtg  TACTACT (J6) 
65  Presentation  ACCTGT  acctgcccaacctttctccc CTATGGTTCGGGGAGTTAT (DXP′1)  gcacgttg  ATACT (J1) 
 Relapse  ACCTGT  acctgcccaacctttctccc CTATGGTTCGGGGAGTTAT (DXP′1)  gcacgttg  ATACT (J1) 
  GCAAGA  gacgaaa  TATGATAGTAGTGG (D21/9) ggcctattggg  CTACT (J6)  
44  Presentation  GCGAGA ggg  AGGACTGGAACTA (DLR1)  cccccggga  TTCGACC (J5) 
 Relapse  GCGAGA  ggg  AGGACTGGAACTA (DLR1) cccccggga  TTCGACC (J5)  
  ACCAAGA tcgagaaggagaagacccca  TATAGCAGCTCGT (DN4/M4) –  ACTACTTTGACTA (J4) 

Patient 65 had 1 PCR-amplified clone at presentation and 2 at relapse; patient 48 had 4 clones at presentation and 2 at relapse; only the major clones were sequenced. Patient 44 had 1 PCR-amplified clone at presentation and 2 at relapse.

Close Modal

or Create an Account

Close Modal
Close Modal