Clonal Evolution During Disease Progression
Patient . | Stage . | FR3A Sequence . | N Sequence . | D Sequence . | N Sequence . | J Sequence . |
---|---|---|---|---|---|---|
48 | Presentation | GCGAGG | tagttaggatgg | TGTAGGAGTA (DLR4) | ttgtgtgtagaa | GGTA (J6) |
GCGA | aagatccccatgtggggt | GTAGTAACCAGCTG (DLR4) | ttatagtata | TACTAC (J6) | ||
Week 2 | GGAG | — | TAGTAG (DLR4) | gttgt | TACT (J6) | |
GGAG | taggttag | GTAG (DLR4) | ttgggatcg | TACT (J6) | ||
Relapse | GCGAG | gccccccg | AGTAGTA (DLR4) | taaggggaaccgc | CTACTACTACTA (J6) | |
GCGAGA | gatcgagagagattgcc | TATTGTAGTAGTACCAGCTGCTAT (DLR4) | agtg | TACTACT (J6) | ||
65 | Presentation | ACCTGT | acctgcccaacctttctccc | CTATGGTTCGGGGAGTTAT (DXP′1) | gcacgttg | ATACT (J1) |
Relapse | ACCTGT | acctgcccaacctttctccc | CTATGGTTCGGGGAGTTAT (DXP′1) | gcacgttg | ATACT (J1) | |
GCAAGA | gacgaaa | TATGATAGTAGTGG (D21/9) | ggcctattggg | CTACT (J6) | ||
44 | Presentation | GCGAGA | ggg | AGGACTGGAACTA (DLR1) | cccccggga | TTCGACC (J5) |
Relapse | GCGAGA | ggg | AGGACTGGAACTA (DLR1) | cccccggga | TTCGACC (J5) | |
ACCAAGA | tcgagaaggagaagacccca | TATAGCAGCTCGT (DN4/M4) | – | ACTACTTTGACTA (J4) |
Patient . | Stage . | FR3A Sequence . | N Sequence . | D Sequence . | N Sequence . | J Sequence . |
---|---|---|---|---|---|---|
48 | Presentation | GCGAGG | tagttaggatgg | TGTAGGAGTA (DLR4) | ttgtgtgtagaa | GGTA (J6) |
GCGA | aagatccccatgtggggt | GTAGTAACCAGCTG (DLR4) | ttatagtata | TACTAC (J6) | ||
Week 2 | GGAG | — | TAGTAG (DLR4) | gttgt | TACT (J6) | |
GGAG | taggttag | GTAG (DLR4) | ttgggatcg | TACT (J6) | ||
Relapse | GCGAG | gccccccg | AGTAGTA (DLR4) | taaggggaaccgc | CTACTACTACTA (J6) | |
GCGAGA | gatcgagagagattgcc | TATTGTAGTAGTACCAGCTGCTAT (DLR4) | agtg | TACTACT (J6) | ||
65 | Presentation | ACCTGT | acctgcccaacctttctccc | CTATGGTTCGGGGAGTTAT (DXP′1) | gcacgttg | ATACT (J1) |
Relapse | ACCTGT | acctgcccaacctttctccc | CTATGGTTCGGGGAGTTAT (DXP′1) | gcacgttg | ATACT (J1) | |
GCAAGA | gacgaaa | TATGATAGTAGTGG (D21/9) | ggcctattggg | CTACT (J6) | ||
44 | Presentation | GCGAGA | ggg | AGGACTGGAACTA (DLR1) | cccccggga | TTCGACC (J5) |
Relapse | GCGAGA | ggg | AGGACTGGAACTA (DLR1) | cccccggga | TTCGACC (J5) | |
ACCAAGA | tcgagaaggagaagacccca | TATAGCAGCTCGT (DN4/M4) | – | ACTACTTTGACTA (J4) |
Patient 65 had 1 PCR-amplified clone at presentation and 2 at relapse; patient 48 had 4 clones at presentation and 2 at relapse; only the major clones were sequenced. Patient 44 had 1 PCR-amplified clone at presentation and 2 at relapse.