Table 1.

Sequences of bcl-2/JH MBR Junctions Detected by Multiple Seminested PCR on Total DNA Extracted From OCI LY8 Tumor, 2 Cases of HD-Involved Lymph Nodes, and 2 Cases of Reactive Lymph Nodes

DNA Sample Cases N Region Length (bp) Bcl-2MBR Position N- and D- Regions JHSegment and Position
(A) OCI LY8   40  GGTGCTTAC (3078) ccggcgccccgttaccccctgtgtgcgaatgggatgaaaa  (2961/J6) TACGGTATG  
(B) HD-involved lymph nodes  1   2a 2b  7 15 13  ATGCAGTGG (3071) GCTTTCTCA (3036) CTTACGCTC (3082)  cacatat caacaaaaggcaaag agggaccagaatc (2359/J5) TGGTTCGAC (2948/J6) T(TAC)5GGTA (1924/J4) ACTGGGGCC 
(C) Reactive lymph nodes  1a 1b 2a 2b  17 2 27 29  GTGGTGCTT (3076) CAGTGGTGC (3074) AACCAGACC (3119) CGCTCCACC (3086) ttcttccccggttcagt gt cgacctcccttccgtgggtagaggaaa ttgtcccgtagtgggccccaccatgggtt  (2960/J6) CTACGGTAT (2952/J6) (TAC)4GGTAT (2971/J6) ACGTCTGGG (2954/J6) C(TAC)3GGTA 
DNA Sample Cases N Region Length (bp) Bcl-2MBR Position N- and D- Regions JHSegment and Position
(A) OCI LY8   40  GGTGCTTAC (3078) ccggcgccccgttaccccctgtgtgcgaatgggatgaaaa  (2961/J6) TACGGTATG  
(B) HD-involved lymph nodes  1   2a 2b  7 15 13  ATGCAGTGG (3071) GCTTTCTCA (3036) CTTACGCTC (3082)  cacatat caacaaaaggcaaag agggaccagaatc (2359/J5) TGGTTCGAC (2948/J6) T(TAC)5GGTA (1924/J4) ACTGGGGCC 
(C) Reactive lymph nodes  1a 1b 2a 2b  17 2 27 29  GTGGTGCTT (3076) CAGTGGTGC (3074) AACCAGACC (3119) CGCTCCACC (3086) ttcttccccggttcagt gt cgacctcccttccgtgggtagaggaaa ttgtcccgtagtgggccccaccatgggtt  (2960/J6) CTACGGTAT (2952/J6) (TAC)4GGTAT (2971/J6) ACGTCTGGG (2954/J6) C(TAC)3GGTA 

Numbers between brackets are the nucleotide positions ofbcl-2 and JH at crossover sites, based on the published sequences. (A) Sequencing analysis of t(14;18)/MBR-rearranged bands of OCI LY8 tumor showed a bcl-2/JH junctional sequence corresponding to the previously known sequence of this cell line by our own previous experiments. The same DNA sequence was also obtained from two products of single cell PCR performed on OCI LY8 tumor tissue sections. (B) Two cases of HD-involved lymph nodes are studied by direct sequencing analysis of the bcl-2/JH junctional region. In case 1, five PCR runs performed on the same DNA sample gave five rearranged bands of similar size. The sequence of the bcl-2/JH junctional region of these five rearranged bands detected by gel electrophoresis was identical, thus confirming the clonal relationship of the t(14;18)-carrying cell population in the HD-affected lymph node, whereas case 2 gave bcl-2/JH rearranged bands of different size from the five PCR runs performed on the same DNA sample. As expected, sequence analysis of the rearranged bands showed different bcl-2/JH junctional region sequence (2 sequences [2a and 2b] from 2 PCR runs are given as an example), confirming the presence of different t(14;18)-bearing cell clones in the lymph node sample. (C) Two cases of reactive lymph nodes are studied by direct sequencing analysis of the bcl-2/JH junctional region. The first case showed five rearranged bands of the same size and the second case gave five rearranged bands of different size in the five seminested PCR performed on the same DNA sample in each case. In case 1, DNA sequencing study of the bcl-2/JH junctional region of the t(14;18)/MBR PCR amplification products demonstrated that only two of the five bands were clonally related (1a). The three other sequences were proven to be different (one sequence [1b] from 1 PCR run is given as an example). In the second case, the presence of a different bcl-2/JH junctional region in each band confirmed the belonging of these bands to different cell population clones (2 sequences [2a and 2b] of 2 PCR runs are given as an example).

or Create an Account

Close Modal
Close Modal