Table 2.

Detection of MRD Using Heminested Fluorescent PCR or Dot Blot Assay

Patient No.TCR RearrangementPatient's Leukemia-Specific ProbeEnd of Induction Therapy, 6-7 Weeks12-15 Weeks35-40 WeeksMRD at End of TherapyLength of First CCR (mo)Status of Disease
CT1 Vδ1Jδ1 ctATTGCGCTTAGTGg +/+ +/− −/− −/− +57 First CCR 
CT2 Vδ1Jδ1 ggatacgCTCTACTTcaccg +/+ +/− +/− NP 12 Relapse BM 
CT3 Vδ3Jδ1 tagGGCCTGGAGCTAcc +/+ +/− −/− −/− +125 First CCR 
CT4 Vδ1Jδ1 gggCCCCATCGGTacac +/+* +/+ +/+ NP 11 Relapse BM 
CT5 Vδ3Jδ1 gcctCTACCGTAGGtag −/− −/− −/− −/− +33 First CCR 
CT6 Vγ2-Jγ1.3 gggCTAGATCCCTAgat +/+ +/+ +/+ NP 20 Relapse BM 
CT7 Vδ3Jδ3 GGTTATGTTGTTGAAGTTCGT +/+ +/+ +/+ NP 20 Relapse BM 
CT8 Vγ6-Jγ1.3 gataggTCCGTTACGTAg +/+* +/+* +/+ NP 10 Relapse BM 
CT9 Vδ1Jδ2 gaactGCATTGGCCTCTAc +/+ +/+ −/− TE +21 First CCR 
CT11 Vδ3Jδ1 AGCAGATCCCGACGGGTA +/+ +/− +/− NP 18 Relapse BM-CNS 
CT12 Vδ2Dδ3 gacACCGGGAGAAATGact +/+* +/+ +/+ TE +18 First CCR 
CT14 Vδ1Jδ1 ggAATTGccactggg +/+* +/+ +/+ NP 12 Relapse BM 
CT15 Dδ2Jδ1 cttcttacTAGCCCAGCG +/+* +/+* NP NP Relapse BM 
CT16 Dδ2Jδ1 cttacGTACCGGATaca +/+ +/− −/− −/− +38 First CCR 
CT18 Vδ2Jδ1 GGGGACTAACTATGCCCC +/+ +/− −/− −/− +55 First CCR 
CT21 Vδ2Jδ1 ctacCCCGAAGCGCCGAG +/+ +/− −/− −/− +33 First CCR 
CT22 Vδ1Jδ1 gggTTAGGTATTTATacac +/+ +/+ −/− −/− +20 First CCR 
Patient No.TCR RearrangementPatient's Leukemia-Specific ProbeEnd of Induction Therapy, 6-7 Weeks12-15 Weeks35-40 WeeksMRD at End of TherapyLength of First CCR (mo)Status of Disease
CT1 Vδ1Jδ1 ctATTGCGCTTAGTGg +/+ +/− −/− −/− +57 First CCR 
CT2 Vδ1Jδ1 ggatacgCTCTACTTcaccg +/+ +/− +/− NP 12 Relapse BM 
CT3 Vδ3Jδ1 tagGGCCTGGAGCTAcc +/+ +/− −/− −/− +125 First CCR 
CT4 Vδ1Jδ1 gggCCCCATCGGTacac +/+* +/+ +/+ NP 11 Relapse BM 
CT5 Vδ3Jδ1 gcctCTACCGTAGGtag −/− −/− −/− −/− +33 First CCR 
CT6 Vγ2-Jγ1.3 gggCTAGATCCCTAgat +/+ +/+ +/+ NP 20 Relapse BM 
CT7 Vδ3Jδ3 GGTTATGTTGTTGAAGTTCGT +/+ +/+ +/+ NP 20 Relapse BM 
CT8 Vγ6-Jγ1.3 gataggTCCGTTACGTAg +/+* +/+* +/+ NP 10 Relapse BM 
CT9 Vδ1Jδ2 gaactGCATTGGCCTCTAc +/+ +/+ −/− TE +21 First CCR 
CT11 Vδ3Jδ1 AGCAGATCCCGACGGGTA +/+ +/− +/− NP 18 Relapse BM-CNS 
CT12 Vδ2Dδ3 gacACCGGGAGAAATGact +/+* +/+ +/+ TE +18 First CCR 
CT14 Vδ1Jδ1 ggAATTGccactggg +/+* +/+ +/+ NP 12 Relapse BM 
CT15 Dδ2Jδ1 cttcttacTAGCCCAGCG +/+* +/+* NP NP Relapse BM 
CT16 Dδ2Jδ1 cttacGTACCGGATaca +/+ +/− −/− −/− +38 First CCR 
CT18 Vδ2Jδ1 GGGGACTAACTATGCCCC +/+ +/− −/− −/− +55 First CCR 
CT21 Vδ2Jδ1 ctacCCCGAAGCGCCGAG +/+ +/− −/− −/− +33 First CCR 
CT22 Vδ1Jδ1 gggTTAGGTATTTATacac +/+ +/+ −/− −/− +20 First CCR 

Results of heminested fluorescent PCR and dot blot assay are reported before and after the slash, respectively.

Abbreviations: NP, not performed (patients relapsed before this time point); BM, bone marrow; TE, too early.

*

Greater than 5% of lymphoblasts detectable by morphologic observation of BM aspirates.

Capital letter indicates the junction sequence of the rearranged segments.

Close Modal

or Create an Account

Close Modal
Close Modal