Sequence of Primers Used in the PCRs
Primer . | Sequence (5′ → 3′)* . | Position (nt)-151 . |
---|---|---|
A | AATGCCACCCTTGCTGG (sense) | 820-836 |
B | AATGCCACCCTTGCTGA (sense) | 820-836 |
C | GCAATGCTCCCAATAATCA (antisense) | 908-890 |
D | gattacgaattcAATGCCACCCTTG (sense) | 820-832 |
X | GCCTCTGTCCTTTGCCAC (sense) | −22 to −5 |
Y | TGGTCACCATGTCCATGGAA (antisense) | 1,262-1,243 |
Primer . | Sequence (5′ → 3′)* . | Position (nt)-151 . |
---|---|---|
A | AATGCCACCCTTGCTGG (sense) | 820-836 |
B | AATGCCACCCTTGCTGA (sense) | 820-836 |
C | GCAATGCTCCCAATAATCA (antisense) | 908-890 |
D | gattacgaattcAATGCCACCCTTG (sense) | 820-832 |
X | GCCTCTGTCCTTTGCCAC (sense) | −22 to −5 |
Y | TGGTCACCATGTCCATGGAA (antisense) | 1,262-1,243 |
*Coding sequence is in capitals; lowercase letters indicate a 12-base extension tail.
nt + 1 is taken as the first nt of the translation initiation codon.