Table 1.

SSCP Screening for Mutations in 87 Unrelated Cases of SCID Due to IL2RG Defects

IL2RG ExonPrimers Surrounding Exons (forward/reverse)Product Size (bp)No. of MutationsMutations With Abnormal SSCPSSCP Sensitivity (%)
aagctatgacagaggaaacgtg/aggcaccagatctctgtacg 292 67 
catttctctttccctccctgc/gagaaaacagtggggtacctgg 297 80 
tgcagtacccagattggcc/tccaatgtcccacagtatccc 291 16 11 69 
ggtattaggggcactaccttcagg/ggccttagctgctacattcacg 254 14 13 93 
agtagcacagatgacactggtgg/tagaaaggctggggtgttgg 312 23 21 91 
cagtgcctggcatgtagtagg/accctcctctgctattgtcagc 225 11 11 100 
tttggtgatggaaggaagcc/acactctgtctgtcttgctggc 271 11 64 
tcctgcccctaattgaccc/cttagggctacaggaccctgg 276 
All exons   87 72 83 
IL2RG ExonPrimers Surrounding Exons (forward/reverse)Product Size (bp)No. of MutationsMutations With Abnormal SSCPSSCP Sensitivity (%)
aagctatgacagaggaaacgtg/aggcaccagatctctgtacg 292 67 
catttctctttccctccctgc/gagaaaacagtggggtacctgg 297 80 
tgcagtacccagattggcc/tccaatgtcccacagtatccc 291 16 11 69 
ggtattaggggcactaccttcagg/ggccttagctgctacattcacg 254 14 13 93 
agtagcacagatgacactggtgg/tagaaaggctggggtgttgg 312 23 21 91 
cagtgcctggcatgtagtagg/accctcctctgctattgtcagc 225 11 11 100 
tttggtgatggaaggaagcc/acactctgtctgtcttgctggc 271 11 64 
tcctgcccctaattgaccc/cttagggctacaggaccctgg 276 
All exons   87 72 83 

or Create an Account

Close Modal
Close Modal