GATA1 mutation analysis and peripheral blood blasts in DS neonates with TAM
| Patient . | Mutation detection by Ss/DHPLC . | Nature and position of mutation detected by Ss . | Nature and position of mutation detected by NGS* . | Effect of mutation . | Bloodblast % . | Clone size by NGS (%) . | Clinical features . |
|---|---|---|---|---|---|---|---|
| DST1 | Ss and DHPLC | G>C point mutation, position 48649737 | Confirmed | Loss of splice donor site | 17 | 56.7 | Jaundice, hepatosplenomegaly, IUGR, A&W 48 mo |
| DST2 | Ss and DHPLC | G>A point mutation, position 48649737 | Confirmed | Loss of splice donor site | 77 | 45.28 | CHD, jaundice, hepatomegaly, A&W 30 mo |
| DST3 | Ss and DHPLC | Deletion 17bp GCGGCACTGGCCTACTA, position 48649688 | Confirmed | Frameshift | 37 | 49.63 | CHD, jaundice, rash, bacterial sepsis, A&W 33 mo |
| DST4 | Ss and DHPLC | dup 20bp 48649670 | 20 bp duplication ACAGCCACCGCTGCAGCTGC, position 48649670 | Frameshift | 35 | 5.96 | Jaundice, preterm (gestation at birth 34 wk), A&W 32 mo |
| DST5 | Ss and DHPLC | A>T mutation at position 48649739 | Confirmed | Loss of splice donor site | 40 | 27.9 | CHD, jaundice, hepatosplenomegaly, coagulopathy, transient spontaneous remission, sudden clinical deterioration with increasing blasts age 2 mo, diagnosed as TAM/ML-DS, Rx: AraC, CCR 24 mo |
| DST6 | DHPLC only | N/A | Clone 1: T>A mutation at position 48649738; clone 2: 1 bp deletion (G) at position 48649666 | Clone 1: loss of splice donor site; clone 2: frameshift | 32 | 10.49 | CHD, jaundice, A&W 57 mo |
| DST7 | Ss and DHPLC | G>A point mutation, position, 48649520 | Confirmed | Premature stop codon | 41 | 3.79 | Jaundice, hepatosplenomegaly, effusions, bacterial sepsis, IUGR, Rx: Ara C, A&W 30 mo |
| DST8 | DHPLC only | N/A | G>T point mutation, position 48649715 | Premature stop codon | 15 | 15.7 | IUGR, A&W 45 mo |
| DST9 | DHPLC only | N/A | 7 bp insertion GGTGAGC position 48649670 | Frameshift | 20 | 3.81 | Nothing of note, A&W 22 mo |
| DST10 | Ss and DHPLC | Insertion CAGTGCCTACT, position 48649704 | Confirmed | Frameshift | 42 | 15.48 | Jaundice, spontaneous remission by 6 wk, ML-DS at 22 mo, Rx: 4 cycles AML chemotherapy, CCR 28 mo |
| DST11 | Ss and DHPLC | Duplication 7bp CCCCTCT, position 48649625 | Confirmed | Frameshift | 38 | 17.06 | Hepatosplenomegaly, rash, CHD, A&W 41 mo |
| DST12† | Ss and DHPLC | 2 bp deletion AG, position 48649606 | Clone 1: 2 bp deletion (AG), position 48649606; clone 2: 8 bp duplication CACCGCTG position 48649675 | Clone 1: frameshift; clone 2, frameshift | 23 | Clone 1: 20.21; clone 2: 0.54 | CHD, jaundice, hepatomegaly, rash, liver failure, spontaneous remission by 2 wk, developed ML-DS age 4 mo, Rx: 4 cycles AML chemotherapy, CCR 34 mo |
| DST13 | Ss and DHPLC | Insertion GCAGCTGGAGCACAGCC, position 48649676 | Confirmed | Frameshift | 50 | 17.07 | Jaundice, hepatomegaly, liver failure, Rx AraC, A&W 36 mo |
| DST14 | Ss and DHPLC | C>T point mutation, position 48649565 | Confirmed | Premature stop codon | 73 | 82.31 | CHD, jaundice, hepatosplenomegaly, coagulopathy, Rx AraC, A&W 49 mo |
| DST15 | Ss and DHPLC | Deletion 14bp GTAACTCCATTGAG, position 48649737 | Confirmed | Loss of splice donor site | 17 | 33 | CHD, jaundice, hepatomegaly, coagulopathy, Rx AraC, A&W 43 mo |
| DST16 | Ss and DHPLC | 2 bp deletion (AG), position 48649600 | ND | Frameshift | 33 | ND | CHD, A&W 51 mo |
| DST17 | DHPLC only | N/A | 2 bp deletion (AG) at position 48649552 | Frameshift | 16 | 3 | Jaundice, A&W 37 mo |
| Patient . | Mutation detection by Ss/DHPLC . | Nature and position of mutation detected by Ss . | Nature and position of mutation detected by NGS* . | Effect of mutation . | Bloodblast % . | Clone size by NGS (%) . | Clinical features . |
|---|---|---|---|---|---|---|---|
| DST1 | Ss and DHPLC | G>C point mutation, position 48649737 | Confirmed | Loss of splice donor site | 17 | 56.7 | Jaundice, hepatosplenomegaly, IUGR, A&W 48 mo |
| DST2 | Ss and DHPLC | G>A point mutation, position 48649737 | Confirmed | Loss of splice donor site | 77 | 45.28 | CHD, jaundice, hepatomegaly, A&W 30 mo |
| DST3 | Ss and DHPLC | Deletion 17bp GCGGCACTGGCCTACTA, position 48649688 | Confirmed | Frameshift | 37 | 49.63 | CHD, jaundice, rash, bacterial sepsis, A&W 33 mo |
| DST4 | Ss and DHPLC | dup 20bp 48649670 | 20 bp duplication ACAGCCACCGCTGCAGCTGC, position 48649670 | Frameshift | 35 | 5.96 | Jaundice, preterm (gestation at birth 34 wk), A&W 32 mo |
| DST5 | Ss and DHPLC | A>T mutation at position 48649739 | Confirmed | Loss of splice donor site | 40 | 27.9 | CHD, jaundice, hepatosplenomegaly, coagulopathy, transient spontaneous remission, sudden clinical deterioration with increasing blasts age 2 mo, diagnosed as TAM/ML-DS, Rx: AraC, CCR 24 mo |
| DST6 | DHPLC only | N/A | Clone 1: T>A mutation at position 48649738; clone 2: 1 bp deletion (G) at position 48649666 | Clone 1: loss of splice donor site; clone 2: frameshift | 32 | 10.49 | CHD, jaundice, A&W 57 mo |
| DST7 | Ss and DHPLC | G>A point mutation, position, 48649520 | Confirmed | Premature stop codon | 41 | 3.79 | Jaundice, hepatosplenomegaly, effusions, bacterial sepsis, IUGR, Rx: Ara C, A&W 30 mo |
| DST8 | DHPLC only | N/A | G>T point mutation, position 48649715 | Premature stop codon | 15 | 15.7 | IUGR, A&W 45 mo |
| DST9 | DHPLC only | N/A | 7 bp insertion GGTGAGC position 48649670 | Frameshift | 20 | 3.81 | Nothing of note, A&W 22 mo |
| DST10 | Ss and DHPLC | Insertion CAGTGCCTACT, position 48649704 | Confirmed | Frameshift | 42 | 15.48 | Jaundice, spontaneous remission by 6 wk, ML-DS at 22 mo, Rx: 4 cycles AML chemotherapy, CCR 28 mo |
| DST11 | Ss and DHPLC | Duplication 7bp CCCCTCT, position 48649625 | Confirmed | Frameshift | 38 | 17.06 | Hepatosplenomegaly, rash, CHD, A&W 41 mo |
| DST12† | Ss and DHPLC | 2 bp deletion AG, position 48649606 | Clone 1: 2 bp deletion (AG), position 48649606; clone 2: 8 bp duplication CACCGCTG position 48649675 | Clone 1: frameshift; clone 2, frameshift | 23 | Clone 1: 20.21; clone 2: 0.54 | CHD, jaundice, hepatomegaly, rash, liver failure, spontaneous remission by 2 wk, developed ML-DS age 4 mo, Rx: 4 cycles AML chemotherapy, CCR 34 mo |
| DST13 | Ss and DHPLC | Insertion GCAGCTGGAGCACAGCC, position 48649676 | Confirmed | Frameshift | 50 | 17.07 | Jaundice, hepatomegaly, liver failure, Rx AraC, A&W 36 mo |
| DST14 | Ss and DHPLC | C>T point mutation, position 48649565 | Confirmed | Premature stop codon | 73 | 82.31 | CHD, jaundice, hepatosplenomegaly, coagulopathy, Rx AraC, A&W 49 mo |
| DST15 | Ss and DHPLC | Deletion 14bp GTAACTCCATTGAG, position 48649737 | Confirmed | Loss of splice donor site | 17 | 33 | CHD, jaundice, hepatomegaly, coagulopathy, Rx AraC, A&W 43 mo |
| DST16 | Ss and DHPLC | 2 bp deletion (AG), position 48649600 | ND | Frameshift | 33 | ND | CHD, A&W 51 mo |
| DST17 | DHPLC only | N/A | 2 bp deletion (AG) at position 48649552 | Frameshift | 16 | 3 | Jaundice, A&W 37 mo |
A&W, alive and well; AraC, cytosine arabinoside; CCR, complete clinical remission; CHD, congenital heart disease; N/A, not applicable; ND, not done; Rx, treatment.
Coordinates refer to human genome, build GRCh37 (hg19).
DST12: 4 copies of RUNX1 in 6% of BM cells at diagnosis of ML-DS by FISH (no other additional cytogenetic abnormalities were detected at diagnosis of TAM or ML-DS in the other cases).