HLA-SNP haplotype content
SNP haplotype . | . | International Histocompatibility Workshop (IHW) reference cell number10 . | ||
---|---|---|---|---|
rs915654* . | rs2075800 . | rs429916 . | HLA haplotype . | |
A | A | A | A*11:01-C*04:01-B*35:01-DRB1*01:01-DQB1*05:01 | 09006 |
A | A | C | A*02:01-C*05:01-B*44:02-DRB1*04:01-DQB1*03:01 | 09090 |
A | G | A | A*68:02-C*04:01-B*53:01-DRB1*15:03-DQB1*06:02 | 09010 |
A | G | C | A*02:01-C*01:02-B*27:05-DRB1*01:01-DQB1*05:01 | 09004 |
T | A | A | A*02:01-C*14:02-B*51:01-DRB1*08:03-DQB1*03:01 | 09070† |
T | A | C | A*31:01-C*04:01-B*35:01-DRB1*04:01-DQB1*03:01 | 09025 |
T | G | A | A*01:01-C*07:01-B*08:01-DRB1*03:01-DQB1*02:01 | 09022, 09023, 09086†, 09088† |
T | G | C | A*03:01-C*07:02-B*07:02-DRB1*15:01-DQB1*06:02 | 09013, 09017, 09081, 09318 |
SNP haplotype . | . | International Histocompatibility Workshop (IHW) reference cell number10 . | ||
---|---|---|---|---|
rs915654* . | rs2075800 . | rs429916 . | HLA haplotype . | |
A | A | A | A*11:01-C*04:01-B*35:01-DRB1*01:01-DQB1*05:01 | 09006 |
A | A | C | A*02:01-C*05:01-B*44:02-DRB1*04:01-DQB1*03:01 | 09090 |
A | G | A | A*68:02-C*04:01-B*53:01-DRB1*15:03-DQB1*06:02 | 09010 |
A | G | C | A*02:01-C*01:02-B*27:05-DRB1*01:01-DQB1*05:01 | 09004 |
T | A | A | A*02:01-C*14:02-B*51:01-DRB1*08:03-DQB1*03:01 | 09070† |
T | A | C | A*31:01-C*04:01-B*35:01-DRB1*04:01-DQB1*03:01 | 09025 |
T | G | A | A*01:01-C*07:01-B*08:01-DRB1*03:01-DQB1*02:01 | 09022, 09023, 09086†, 09088† |
T | G | C | A*03:01-C*07:02-B*07:02-DRB1*15:01-DQB1*06:02 | 09013, 09017, 09081, 09318 |
A total of 163 homozygous individuals were characterized for 12 SNPs of clinical significance. The table shows one representative haplotype for each of the 3 SNP haplotypes defined by rs915654, rs2075800, and rs429916 which were each associated with transplant outcome through the patient’s genotype. A full listing of the 12 SNPs among homozygous individuals is provided in supplemental Table 2.
SNP rs915654 was PCR-amplified from 50 ng genomic DNA (0.42 μM of CAGCTCCAACCCCTCTAACA forward and CCTGCTGATACCCTCCAAAG reverse primers; 1× Apex Hot Start Master Mix [Genesee Scientific]) following 15 min at 95°C activation; 30 s at 95°C denaturation, 30 s at 60°C annealing, 2 min at 72°C extension for 30 cycles; 7 min at 72°C extension, and 4°C hold. Amplified products were sequenced with BigDye Terminator v.3.1 Cycle Sequencing kits and the 3730XL DNA analyzer (Applied Biosystems, Foster City, CA).
IHW09070, IHW09086, and IHW09088 were heterozygous at rs429916.