Oligonucleotide primers used in this study
| Gene/fragment location (bp) . | Method . | Forward sequence (5′ to 3′) . | Reverse sequence (5′ to 3′) . |
|---|---|---|---|
| −371-FLAP promoter HRE-M1 (−170 to −167) | SDM | gtgtgctggctttgcaggctcctctgccaag | cttggcagaggagcctgcaaagccagcacac |
| −371-FLAP promoter HRE-M2 (−251 to −248) | SDM | gcctgtgctgggctcaggctggtcatggtc | gaccatgaccagcctgagcccagcacaggc |
| −371-FLAP promoter NFκB-M1 (−43 to −34) | SDM | ggcactgtgtaattgtgccgaggctctgcagaaattgtaatg | cattacaatttctgcagagcctcggcacaattacacagtgcc |
| −371-FLAP promoter NFκB-M2 (−43 to −34) | SDM | ggcactgtgtaattgtgccgggaagcgtcagaaattgtaatg | cattacaatttctgacgcttcccggcacaattacacagtgcc |
| HRE (−170 to −167) in FLAP promoter | EMSA | ctggctttgcgtgctcctctg | cagaggagcacgcaaagccag |
| HRE mutant in FLAP promoter | EMSA | ctggctttgaaagctcctctg | cagaggagctttcaaagccag |
| FLAP promoter (−310/+9) | ChIP | cagagatgatggcagcttcca | aaggggaagtgagagcttgca |
| Gene/fragment location (bp) . | Method . | Forward sequence (5′ to 3′) . | Reverse sequence (5′ to 3′) . |
|---|---|---|---|
| −371-FLAP promoter HRE-M1 (−170 to −167) | SDM | gtgtgctggctttgcaggctcctctgccaag | cttggcagaggagcctgcaaagccagcacac |
| −371-FLAP promoter HRE-M2 (−251 to −248) | SDM | gcctgtgctgggctcaggctggtcatggtc | gaccatgaccagcctgagcccagcacaggc |
| −371-FLAP promoter NFκB-M1 (−43 to −34) | SDM | ggcactgtgtaattgtgccgaggctctgcagaaattgtaatg | cattacaatttctgcagagcctcggcacaattacacagtgcc |
| −371-FLAP promoter NFκB-M2 (−43 to −34) | SDM | ggcactgtgtaattgtgccgggaagcgtcagaaattgtaatg | cattacaatttctgacgcttcccggcacaattacacagtgcc |
| HRE (−170 to −167) in FLAP promoter | EMSA | ctggctttgcgtgctcctctg | cagaggagcacgcaaagccag |
| HRE mutant in FLAP promoter | EMSA | ctggctttgaaagctcctctg | cagaggagctttcaaagccag |
| FLAP promoter (−310/+9) | ChIP | cagagatgatggcagcttcca | aaggggaagtgagagcttgca |
ChIP indicates chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; and SDM, site-directed mutagenesis. The specific mutations are highlighted in bold type.