Primer sequences for amplification of the Ber-H2 hybridoma immunoglobulin genes
Primer . | Sequence 5′-3′ . | Application . |
|---|---|---|
| BVH | GTGATACCTACTATCCTTCTGTCC | Forward primer for the first amplification of the Ber-H2 IGH gene |
| BVH | ACCTGCAGAGACAATGACC | Reverse primer for the first amplification of the Ber-H2 IGH gene |
| BVH/p | GACTCGACCATGGCAGGTCCAGCTTCAC | Forward primer for the reamplification of the Ber-H2 IGH gene |
| BVH557 | GACTCGACTCGAGGCAGAGACAGTGAC | Reverse primer for the reamplification of the Ber-H2 IGH gene |
| BVL | TGCTGATGGGAACATTGTAA | Forward primer for the first amplification of the Ber-H2 IGK gene |
| BVL | ACGTTTTATTTCCAGCTTGG | Reverse primer for the first amplification of the Ber-H2 IGK gene |
| BVL387 | GACTCGAGTCGACGAACATTGTAATGA | Forward primer for the reamplification of the Ber-H2 IGK gene |
| BVL707 | GACTCGAGCGGCCGCTTTTATTTCCAGC | Reverse primer for the reamplification of the Ber-H2 IGK gene |
Primer . | Sequence 5′-3′ . | Application . |
|---|---|---|
| BVH | GTGATACCTACTATCCTTCTGTCC | Forward primer for the first amplification of the Ber-H2 IGH gene |
| BVH | ACCTGCAGAGACAATGACC | Reverse primer for the first amplification of the Ber-H2 IGH gene |
| BVH/p | GACTCGACCATGGCAGGTCCAGCTTCAC | Forward primer for the reamplification of the Ber-H2 IGH gene |
| BVH557 | GACTCGACTCGAGGCAGAGACAGTGAC | Reverse primer for the reamplification of the Ber-H2 IGH gene |
| BVL | TGCTGATGGGAACATTGTAA | Forward primer for the first amplification of the Ber-H2 IGK gene |
| BVL | ACGTTTTATTTCCAGCTTGG | Reverse primer for the first amplification of the Ber-H2 IGK gene |
| BVL387 | GACTCGAGTCGACGAACATTGTAATGA | Forward primer for the reamplification of the Ber-H2 IGK gene |
| BVL707 | GACTCGAGCGGCCGCTTTTATTTCCAGC | Reverse primer for the reamplification of the Ber-H2 IGK gene |
IGH indicates immunoglobulin heavy chain gene; IGK, immunoglobulin kappa light chain gene.