Table 1.

Primers used

NameNucleotide sequenceGenomic regionPosition*Strandedness
e18c CATACAGCCGGAGGAAGACG Exon 2 73 to 54 Antisense 
e18t CATACAGCCGGAGGAAGACA Exon 2 73 to 54 Antisense  
e26h gatcagaaactcctacCTGACACTTG Exon 2 16† to 85 Antisense 
e26y gatcagaaactcctacCTGACACTTA Exon 2 16† to 85 Antisense  
e80a GCAGCCACCTCACCTCCTTTGC Exon 3 199 to 178 Antisense 
edra2b TCACCTCCTTGGGTACCGTACT Exon 3 190 to 169 Antisense  
edra2x TCACCTCCTTGGGTACCGTACC Exon 3 190 to 169 Antisense 
ei5r CCTCCGTCACATGTTCATAGAGAAG Exon 5 580 to 556 Antisense  
ei11a GTGTGTGGGGATTTTCCTGGAC Exon 11 1068 to 1089 Sense 
ei11b GCCAGGCGACTGAAGTCCAG Exon 11 1493 to 1474 Antisense  
ei11c GGGACTTGTTGGTCACATTGTAG Exon 11 1135 to 1113 Antisense 
en1a gtaaggagaaaggggattatttctctac Intron 1 65 to 92 Antisense 
en1b cacccttgaaaatgttcttgtgcgtaag Intron 1 88 to 115 Antisense 
en10r cataaggaggaagtgctctgagatatg Intron 10 52 to 26 Antisense  
en3r ggcaagtaaaaactacactgcagatg Intron 3 120 to 95 Antisense 
en4r caccagcctgagctcccttac Intron 4 32 to 12 Antisense 
en5r gtggattcttgaaattcccatatatccc Intron 5 342 to 315 Antisense 
en6r ggatatatgtgtgcatgtgtgtacag Intron 6 126 to 101 Antisense  
en7r gtccccatggcttgaattac Intron 7 125 to 106 Antisense 
ev1a gagtcaagcgattacttcagctcac Promoter −2106 to −2082 Sense 
ev1b gcctcctctttgctctgttc 5UTR −278 to −259 Sense  
ev2a gcctcggctcctgggttatac Intron 1 −77 to −57 Sense 
ev2b tctgtcacgccaagcccatcag Intron 1 −54 to −33 Sense  
ev2c agcccgcttgtgctgtctcc Intron 1 −34 to −14 Sense 
ev3a ctcatcccttcccaagctttc Intron 2 −65 to −45 Sense  
ev3b ctcccagttggccttgtctc Intron 2 −33 to −14 Sense 
ev3c cattatgtcttttggggttctgttc Intron 2 −156 to −132 Sense  
ev4a ccatctgaggcatgccagaag Intron 3 −68 to −48 Sense 
ev4b gacatctccctgaggtcag Intron 3 −41 to −23 Sense  
ev5a atgcccgcttacctgtagtgac Intron 4 −125 to −104 Sense 
ev6a gggaggtggaggtgaagatag Intron 5 −117 to −97 Sense  
ev7a gagtgatgaggctgccacag Intron 6 −80 to −61 Sense 
ev8a cattatgggagggcctctacatag Intron 7 −65 to −42 Sense  
ev8b gggtatagctattgagtatctgtctg Intron 7 −115 to −90 Sense 
ev11a ctaaaatgggctaatgacagtgatgg Intron 10 −116 to −91 Sense  
ev11b acagtgatggcagacctaagattc Intron 10 −100 to −77 Sense 
en11a TCACTGTGATAGTTAATCTTATGTATCCAC Exon 11 3122 to 3093 Antisense 
NameNucleotide sequenceGenomic regionPosition*Strandedness
e18c CATACAGCCGGAGGAAGACG Exon 2 73 to 54 Antisense 
e18t CATACAGCCGGAGGAAGACA Exon 2 73 to 54 Antisense  
e26h gatcagaaactcctacCTGACACTTG Exon 2 16† to 85 Antisense 
e26y gatcagaaactcctacCTGACACTTA Exon 2 16† to 85 Antisense  
e80a GCAGCCACCTCACCTCCTTTGC Exon 3 199 to 178 Antisense 
edra2b TCACCTCCTTGGGTACCGTACT Exon 3 190 to 169 Antisense  
edra2x TCACCTCCTTGGGTACCGTACC Exon 3 190 to 169 Antisense 
ei5r CCTCCGTCACATGTTCATAGAGAAG Exon 5 580 to 556 Antisense  
ei11a GTGTGTGGGGATTTTCCTGGAC Exon 11 1068 to 1089 Sense 
ei11b GCCAGGCGACTGAAGTCCAG Exon 11 1493 to 1474 Antisense  
ei11c GGGACTTGTTGGTCACATTGTAG Exon 11 1135 to 1113 Antisense 
en1a gtaaggagaaaggggattatttctctac Intron 1 65 to 92 Antisense 
en1b cacccttgaaaatgttcttgtgcgtaag Intron 1 88 to 115 Antisense 
en10r cataaggaggaagtgctctgagatatg Intron 10 52 to 26 Antisense  
en3r ggcaagtaaaaactacactgcagatg Intron 3 120 to 95 Antisense 
en4r caccagcctgagctcccttac Intron 4 32 to 12 Antisense 
en5r gtggattcttgaaattcccatatatccc Intron 5 342 to 315 Antisense 
en6r ggatatatgtgtgcatgtgtgtacag Intron 6 126 to 101 Antisense  
en7r gtccccatggcttgaattac Intron 7 125 to 106 Antisense 
ev1a gagtcaagcgattacttcagctcac Promoter −2106 to −2082 Sense 
ev1b gcctcctctttgctctgttc 5UTR −278 to −259 Sense  
ev2a gcctcggctcctgggttatac Intron 1 −77 to −57 Sense 
ev2b tctgtcacgccaagcccatcag Intron 1 −54 to −33 Sense  
ev2c agcccgcttgtgctgtctcc Intron 1 −34 to −14 Sense 
ev3a ctcatcccttcccaagctttc Intron 2 −65 to −45 Sense  
ev3b ctcccagttggccttgtctc Intron 2 −33 to −14 Sense 
ev3c cattatgtcttttggggttctgttc Intron 2 −156 to −132 Sense  
ev4a ccatctgaggcatgccagaag Intron 3 −68 to −48 Sense 
ev4b gacatctccctgaggtcag Intron 3 −41 to −23 Sense  
ev5a atgcccgcttacctgtagtgac Intron 4 −125 to −104 Sense 
ev6a gggaggtggaggtgaagatag Intron 5 −117 to −97 Sense  
ev7a gagtgatgaggctgccacag Intron 6 −80 to −61 Sense 
ev8a cattatgggagggcctctacatag Intron 7 −65 to −42 Sense  
ev8b gggtatagctattgagtatctgtctg Intron 7 −115 to −90 Sense 
ev11a ctaaaatgggctaatgacagtgatgg Intron 10 −116 to −91 Sense  
ev11b acagtgatggcagacctaagattc Intron 10 −100 to −77 Sense 
en11a TCACTGTGATAGTTAATCTTATGTATCCAC Exon 11 3122 to 3093 Antisense 

5UTR indicates 5 untranslated region of exon 1.

*

The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG in the cDNA for all primers in the promoter and in the exons including the 3 untranslated region of exon 10, or relative to their adjacent exon/intron boundaries for all other primers.

†

Intron 2

View Large
This Feature Is Available To Subscribers Only

or Create an Account

Close Modal
Close Modal